Q: Describe how vesicles are cycled in the presynaptic terminal. Use a diagram if necessary
A: The science of cell structure and function is known as cell biology, and it is based on the idea…
Q: The following is an ion present in the total body fluid: O a. Electron O b. Electrolyte O c. Proton…
A: Body fluid is defined as the liquid found within the human body. It may be classified into two main…
Q: The pattern of growth of any organism is controlled by hormones homeostasis genes anabolic and…
A: Introduction :- Any self-regulating process, such as homeostasis, helps an organism retain stability…
Q: 1 2. T B Type here to search Required The diagram below represents a cell. Carbon dioxide (CO₂) and…
A: Cell The basic structural and functional entity of every living organisms except viruses and few…
Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle? ODNA…
A: A checkpoint is a stage in the eukaryotic cell cycle where the cell examines internal and external…
Q: The following type of metabolic reaction add together monomers (small repeating building blocks or…
A: Any self-regulating process, such as homeostasis, helps an organism retain stability while…
Q: Bicarbonate ion (HCO3) is a type of the following: Oa. Acid O b. Base O c. Buffer O d. Salt Oe. None…
A: Introduction :- Another name for bicarbonate is HCO3. It's a result of the metabolism in your body.…
Q: Compare the primary mechanisms used by the sympathetic and parasympathetic divisions to clear or…
A: The autonomic nervous system functions to regulate the body's unconscious actions. The sympathetic…
Q: medical/biomedical model defines "health" as total wellbeing mind, body, spirit the absence of…
A: A medical or Biomedical model of health is the most accepted model of health in western countries.…
Q: A healthy couple had their first child affected by cystic fibrosis. Their next three sons were not…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homozygous…
Q: Which of the following would inhibit the activity of TGF-Beta receptor? multiple answers A.…
A: Signaling molecules in the body allow cells to react to altering external surroundings. Cells…
Q: Which of the following will NOT happen either in prophase, metaphase, anaphase, telophase? O…
A: Cell cycle It is defined as all those changes that occur during the cell growth and cell division…
Q: A nutritionist is interested in collecting data to develop a healthy eating program at a local high…
A: A graph is a pictorial representation or diagram that represents data or values in an organised way.
Q: Some silent mutations have been found to be associated with disease. Suggest a possible mechanism…
A: Introduction : The DNA sequence varies from species to species. Base-pair sequence alterations are…
Q: How does the level of spinal cord injury relate to expected functional losses and clinical…
A: Introduction The spinal cord is the main component of the CNS (Central Nervous System) which…
Q: What is the relationship between cholecystitis and cholelithiasis?
A: Gallstone disease is the most common disorder affecting the biliary system, which is the body's bile…
Q: Differentiate Brownian movement and true motility
A: All living things, including microbes, require movement. They prefer beneficial substances such as…
Q: Please write a detailed description of its structures, characteristics, and functions of proteins.
A: Introduction Amino acids are the building blocks of proteins. Two amino acids are joined by a…
Q: You are exploring the Amazon rainforests before it was completely destroyed. Particularly, you focus…
A: Introduction The term "gene" can be interpreted in a number of ways. The molecular gene is a…
Q: Which key step happens during anaphase? O replication of chromosomal DNA in the nucleus O…
A: Introduction DNA replication, cytokinesis, and cell division are all steps in the process of cell…
Q: what do you think is the coolest metabolic process for energy-producing nutrients?
A: All living organisms require energy for various living processes such as growth, reproduction,…
Q: The tickle response can also trigger escape movements, increased heart rate and tears. What type of…
A: Introduction The neuron, a specialised cell created to send information to other nerve cells,…
Q: You are working to develop drugs that can target bacterial infections or fungal infections. Please…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Answers A-D A Current from neighboring regions can trigger a second action potential in phase 2 B…
A: Introduction A transient voltage change (membrane potential) across the cell membrane of heart…
Q: Here are some key traits that distinguish the three domains of life (some of which are from the…
A: Classification: It aids in the identification of living creatures as well as the comprehension of…
Q: The following type of metabolic reaction breaks down a polymer (large structure) into monomers…
A: Biochemistry is a subdivision of biological science that involves the study of biochemical reactions…
Q: What is the explanation for the existence of the blind spot based on what is anatomically present…
A: The human eye is a sensory organ that responds to visible light and allows us to use visual…
Q: Describe the action potential in terms of the different functional states of the voltage- gated Na+…
A: Introduction Action potential is the short term change in the electric…
Q: There are large endocrinocytes in the wall of the follicles and in the interfollicular layers of the…
A: A important hormone gland, the thyroid gland is important for the growth, development, and…
Q: Which property is illustrated in the following examples? A bacterium makes a copy of itself,…
A: Every living organisms shows some defining properties such as reproduction, growth, cellular…
Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle? ODNA…
A: Introduction :- In the eukaryotic cell cycle, a checkpoint is a time where the cell evaluates both…
Q: If I have to compare this organelle to the offices in the city, it is the Cotabato Light Company for…
A: Cell is the basic structural and functional unit of life. It has various organelles such as…
Q: How old are the first recognizable mammals relative to the K/T boundary layer (i.e., extinction of…
A: We are allowed to do upto three subpart of a question. Please repost the undone question again.…
Q: How do plants have the answer to saving the world ? How are plants helping the United Nations with…
A: Green plants are capable of giving us food by the process of photosynthesis. This is a process in…
Q: Cellular stains are commonly used in bacteriology. Which of the following is NOT a reason to stain a…
A: Introduction :- Cell staining is a method that can be applied to improve microscopic views of cells…
Q: You obtain a patient sample and need to grow all bacteria that are found in the sample. What five…
A: Bacteria are both beneficial and detrimental. Food cannot be digested if there are no bacteria, and…
Q: How are congenital disorders, such as cerebral palsy, hydrocephalus, and spina bifida, manifested in…
A: One percent of all babies born in the United States each year are affected by congenital disorders,…
Q: What is the likely result if you try to use the 100X objective without immersion oil?
A: Introduction :- To prevent any air gaps and light loss owing to refraction (bending of the light)…
Q: How does the lipid or water solubility of hormones affect their transport in the circulation?
A: Hormones are chemical messenger which travels via the blood to various parts of the body to its…
Q: How has the study of human biology and variation in this class changed how you think about race and…
A: Introduction The study of humans through the influences and interactions of many different academic…
Q: Plasma is the fluid component of the following: O a. Intracellular Fluid (ICF) Ob. Blood Oc.…
A: Plasma is necessary to help your body recover from injury, distribute nutrients, remove waste and…
Q: How do we know that cancer cells often contain defects inDNA repair?
A: Introduction Cancer is a popular disease now a day. In the US, 1 in 2 women and 1 in 3 men develop…
Q: A fishing spider walks along the surface of water to hunt for tadpoles. Which characteristic of…
A: The two emergent properties of water includes; Cohesion - it is the hydrogen bonding of water…
Q: Below are six faces. Each face represents a species. Seven characters are listed in the table, along…
A: Introduction : A genetically determined characteristic or condition is known as trait. It is the…
Q: cytoplasmic determinants
A: Stem cells are the specialised cells of body which have continuous power of division and power of…
Q: average membrane pore radius for this membrane using this information.
A: Given, Average radii=1nm Conc. of filtrate = 2.17 g/L Conc. of feed-side surface = 8.52 g/L Mass…
Q: How does mitosis result in daughter cells containing identical number and same DNA with its parent…
A: MITOSIS It is also called the indirect / somatic or equational cell division. Daughter cells have…
Q: What are the primary nutrients and how are they metabolized by cells?
A: Introduction Our food comprises three primary nutrients: carbohydrates, proteins, and fats. These…
Q: What is a stromatolite? Why are they more common in the fossil record that in modern times? What do…
A: Introduction :- Layered sedimentary structures known as stromatolites or stromatoliths are primarily…
Q: Which of the following modifications of the Epithelial Growth Factor Receptor (EGFR) would be…
A: Epidermal growth factor receptor is a transmembrane protein that spans the length of the cell…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
What amino acid sequence does this RNA sequence code for? ACU GAG AGC ACG?
Step by step
Solved in 3 steps
- The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GGiven the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.The name for the kind of point mutation/base substitution when a codon changes from CCC (which codes for proline) to CGC (which codes for arginine) is mutation. 2nd base in codon U CAG Cys Cys STOP STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Phe U Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln C Asn Asn lle lle lle Met Thr Thr Thr Thr Ala Ala Ala Ala Lys Lys Asp Asp Glu Glu Val Val Val Val 3rd base in codon DCAGUCAGUCAGUCAG 1st base in codonWhat amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter abbreviation with hyphens and no spaces in between.
- how do you translate this sequence RNA A C U G U C A U G A G C C C U G C A A G G A A G C U C G A G U A A G C AWhat RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?
- Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterUsing the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, GlycineThe amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA sequence that would encode this oligopeptide (tiny protein). Label the 5' and 3' ends of the mRNA.