Use the table of the codons to answer the following question. Starting with the start codon, what is the sequence of the peptide th translated from the mRNA AGAUGAAAGACGCGCUAUUGUGACGU Arg Lys Thr Arg Tyr Cys Asp Arg Met Lys Asp Ala Leu Leu Asp Lys Gln Ala Ile Val Ser Cys
Q: Which of the following mechanisms ensure that the utilization of dietary nucleic acids is effected?…
A: Purine and pyrimidine biosynthesis occurs from the waste products of other metabolic pathways like…
Q: Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon…
A: Adenine, Guanine, Cytosine, and Thymine are the nitrogenous bases present in DNA. Adenine and…
Q: Based on the degree of saturation which lipid is a better choice to spread on food, butter or…
A: A lipid with a lesser degree of saturation is unharmful to health. Highly saturated lipids build up…
Q: I. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: Fatty acid oxidation is the process in which long-chain fatty acids are converted into acetyl-CoA.…
Q: 2. The kinetics of an enzyme are measured as a function of substrate concentration in the presence…
A: The enzymes catalysts that facilitate biochemical reactions. The enzymes are inhibited in presence…
Q: A receptor, R, binds to its ligand, L, according to the binding curve shown below. If [R]= 30 mM at…
A: Kd is dissociation constant which is ligand concentration at half of the saturation of receptors or…
Q: Metabolite 3 The common name for metabolite 3 How does its structure differ from diazepam? -OH
A: Oxazepam, like the related 3-hydroxybenzodiazepine lorazepam. Oxazepam is thought to be less prone…
Q: 1.0 0 0.5 0 5 Ligand A Ligand B 10 15 20 25 Ligand Ligand D 40 45 50 55 60 30 35 [Ligand] (MM)
A: Kd is dissociation constant which is ligand concentration at half of saturation or at 0.5 theta…
Q: A GRK inhibitor would have what effect on GPCR inactivation in the presence of a GPCR agonist? (a)…
A: Agonists are substances which mimic the activity of a ligand. The activation of the GPCR triggers a…
Q: Glycolysis consists of three irreversible steps. Which of the following enzyme- catalyzed reaction…
A: Glycolysis is the first stage of cellular respiration during which glucose is converted to pyruvate…
Q: Which of the following statements is incorrect? The rigidity of a saturated fatty acid is…
A: The biological macromolecules can be classified as nucleic acids, proteins, lipids and…
Q: Modify isoleucine to show the predominant forms at pH 1, 7, and 13. Isoleucine has pK, values of 2.4…
A: Proteins are polymer of amino acids , and each of the amino acid residue is linked to its…
Q: d Question # 6. On the right is a schematic showing the structure of complex V (ATP Synthase). The…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: WASTE OF ALCOHOL DISTILLERY PLANT GIVE 2 WASTE WASTE WASTE WHEN MANUFACTURING ALCOHOL
A: Distillery plants are the ones that are widely used for the purpose of manufacturing alcohol. This…
Q: Fatty acid synthesis requires the activation of acetyl CoA to malonyl CoA. However, its condensation…
A: Fatty acids are broken down to acetyl Co-A and the precursor for the fatty acid synthesis is acetyl…
Q: Explain the biochemical basis of diarrhea.
A: Diarrhea is abnormally loose or watery stool, more-frequently associated with altered bowel…
Q: P P₂ 2 E*-P₁-P₂ E*-P₂ E* E E-S₁ E-S₁-S₂ Which of these 2 options represents a Sequential Ordered…
A: Enzymes are very important ad highly effective catalysts, having the ability to enhance the reaction…
Q: 1) under intracellular conditions, answer : If G3P-DH is inhibited by Iodoacetic acid, which…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: What do COX enzymes synthesise?
A: Arachidonic acid acts as the precursor of the molecules known as eicosanoids. There are two pathways…
Q: Which of the following is NOT a regulatory mechanism for digestion? Only carbohydrates are digested…
A: Introduction: The process by which our body breaks down food into small nutrient molecules is known…
Q: 53. A 16-year-old high school student comes to the office because she thinks she is pregnant. A…
A: The complete span of pregnancy is divided into terms. The pregnancy hormone is referred to as…
Q: Km V. (V) 15) + V = [S] max a' = 2 a' = 1.5 (7) -15⁰° max a Vmax 1 [S] MM a'=1 [1]
A: Most of the enzymes have certain kinetic properties. whenever a substrate is added to them, the…
Q: Briefly explain why allosteric inhibition is an example of negative heterotropic cooperativity and…
A: Heterotropic interactions observed in which the substrate binds to the enzyme at only one site and a…
Q: II. ATP ACCOUNTING Provide what is being asked for. Show all relevant calculations and summarize…
A: Lactose gets broken down to equivalent moles of Galactose and Glucose by the enzyme lactase present…
Q: What is the role of tyrosine in prostaglandin synthesis? Tyrosine provides the proton to the double…
A: Prostaglandins are mostly produced from Arachidonic acids( a C20 poly-unsaturated fatty acids) in…
Q: Which are the FIVE main series of apoproteins that have been identified? "apoA, apoB, apoC,…
A: Introduction: Apolipoproteins are the protein components of lipoproteins, the lipid-protein…
Q: * Glycerol is used for cosmetic preparations and synthesis of suppositories True False
A: Glycerol - Polyol compound and is colorless, odorless; a viscous liquid
Q: An increase in blood levels of which of the following increase the risk for atherosclerosis?…
A: Every cell in the body needs cholesterol to form cell membrane layers. These layers protect the…
Q: Consider a yeast cell undergoing fermentation but with defective alcohol dehydrogenase (hint: In…
A: The oxidation-reduction reaction is also called the Redox reaction. This reaction involves the…
Q: Among other effects, insulin is a positive modulator of the enzyme glucokinase in liver cells. If…
A: Insulin is a polypeptide hormone, which is produced by the β cells of the islets of Langerhans in…
Q: What metabolic strategies are employed to oxidize a saturated carbon? Dehydrogenation/elimination…
A: Saturated Carbon :- As carbon have 4 electron to share in its outermost shell so carbon form bonds…
Q: What is the common precursor of all phospholipids and TAG? Phosphatidic acid…
A: Phospholipids are a group of hydrophilic phosphate heads and hydrophobic tails. phospholipids are…
Q: why is energy released when IMFs form in between molecules as they approach eachther
A: In molecular terms, intermolecular forces are the forces of attraction and repulsion between…
Q: Which abbreviation is this following peptide? GKH QGR HK GHK GHL
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Consider a brain cell with non-functional Complex II of the electron transport chain (Assume that…
A: Lactose is composed of glucose and galactose units. Glucose can directly enter the glycolysis while…
Q: Using good details, compare and contrast the pairs of different biochemical reactions. Create your…
A: Introduction: The term metabolism describes the interconversion of chemical compounds in the body…
Q: A patient of 28 years old complains of pains in the spine, persistent arterial hypertension. On…
A: Hi! Since you have posted a multiple subparts questions and haven't mentioned which subparts to be…
Q: Which of the following is NOT a regulatory mechanism for catabolism and anabolism? Phosphorylation…
A: Metabolism is a series of interconnected chemical reactions occurring within a cell. Metabolic…
Q: Which of the following describe active transport or is an example of transport of a substance across…
A: The basic constituent of the cell membrane is that it is a phospholipid bilayer. The different kinds…
Q: Suppose there is a ligand binding pocket in this alpha-helix that contains residues of Leu (2), Phe…
A: Globular protein contains van der waals interactions , disulphide bridges , diploar interactions(…
Q: The free energy difference going from the unfolded state to the folded state in most proteins is…
A: The three dimensional structure of proteins ca b e destroyed by denaturating the protein. This…
Q: Consider a 24:1 △cis-9 fatty acid in the mitochondrion. For each fatty acid given, determine the…
A: Fatty acid oxidation is the process in which long-chain fatty acids are converted into acetyl-CoA.…
Q: 10 n 0 progress of reaction A graph of the free energy changes that take place during a reaction is…
A: Chemical reactions are classified into two types. Exergonic reactions that take place with the…
Q: What are ROS and examples of ROS? How do they affect the cells resulting in aging?
A: Reactive oxygen species (ROS) are oxygen-containing radicals with one or more unpaired electrons…
Q: The protein's secondary structure provide the overall arrangement of atoms. True or false
A: The secondary structure - Formed due to hydrogen bonds formed b/w the atoms of the polypeptide…
Q: What do think would happen to an individual if he/she only eats steamed "sweet potato" or "kamote"…
A: A healthy diet is very important in maintaining a healthy and disease-free lifestyle for…
Q: ALL biosynthetic reactions require which of the following metabolites(s)? NADPH Glucose 6-P High…
A: Biosynthetic reactions are the reactions that are catalysed by Enzymes to synthesise more complex…
Q: Name the monomers for all the macromolecules in Test Tubes 1-5 in Jenny's experiment. Benedict's…
A: Living organisms are constituted of four types of biological macromolecules nucleic acids, proteins,…
Q: A DNA molecule rich in C-G base pairs will have less hydrogen bonds between its two strands compared…
A: DNA, as well as RNA, belongs to the class of macromolecules. They are known to store genetic…
Step by step
Solved in 2 steps with 1 images
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GUse the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First Position
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine Threonine
- Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonw/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfTable 8.2 Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU O nonsense Oleucine Refer to Table 8.2. UAU codes for which amino acid? O lysine O alanine Phenylalanine UAU leucine UAA alanine lysine valine UCG, UCU O tyrosine AAU UGC tyrosine nonsense asparagine cysteine serine