Below is the sequence of MRNA. 1. if U is mutated to C, then it will lead to a [ Select ) mutation. 2. if U is mutated to A, then it will lead to a ( Select) mutation. 3. if U is mutated to G, then it will lead to a ( Select ) mutation.

Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?

You are given the following mRNA sequence. You know that it contains some UTR sequence and the beginning of the coding sequence of a gene. 5’ ACGGUAUCUAUGGAUUCUGAGGUUGCUGCUUUGGUUAUU 3’ Part A: Write the amino acid sequence for this portion of the coding sequence. Part B: Write the double-stranded DNA sequence that corresponds to the mRNA above. Label 5’ and 3’ ends. Would transcription have occurred using the top or bottom strand as the template?

Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part: 3/5 Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACT

Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACT Leu-Thr-His Part: 4/5 Part 5 of 5 What is the amino acid sequence if G is added to the beginning of the chain? x S

A mRNA sequence is shown below.  Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA.  The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine.      45              50              55               60             65              5’—A A C G A A U C G U C G C C A A C U A A G A G  –-3’     Which of the following DNA mutations is almost certain to result in a shorter than normal protein?         at position 56 a change from G to C     an insertion of a G after the G at position 56     inversion of region 56-59 (G C C A)     an delete the C at position 52     None of the above.

An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the sequence to give it a missense mutation. Circle/highlight the mutation. Explain how your specific mutation would affect the formation and structure of the 2nd (middle) Base of a Codon 1st U CA G 3rd Base Base UUU Phe UUC Phe UUA Leu UUG Leu UCU Phe UCC Phe UCA Leu UCG Leu UAU Tyr UAC Tyr UAA STOP UAG STOP UGU Cys UGC Cys UGA STOP UGG Trp protein. U CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro ССС Pro CCA Pro CCG Pro CAU His CAC His CAA Gln CAG Gln CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg AAU Asn AAC Asn AUU lle AUC lle AUA lle AUG Met ACU Thr ACC Thr ACA Thr ACG Thr A AAA Lys AAG Lys GUU Val GUC Val GUA Val GUG Val GCU Ala GCC Ala GCA Ala GCG Ala GAU Asp GAC Asp GAA Glu GAG Glu GGU Gly GGC Gly GGA Gly GGG Gly UCAG

You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3

The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’

Read instrxutions and complete MRNA CODON TABLE.