The template strand of wild- type gene A is shown below. On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' TCAACGACTCTACCCTTTGCAAGAGGGCAT 3'
Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…
A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…
Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…
A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…
Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…
A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…
Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Central dogma is the process where in the information stored in nucleic acids is transferred to…
Q: Arrange the following components of translation in the approximate order in which they would appear…
A: In prokaryotes, the protein synthesis takes place in the cytoplasm. It comprises two steps…
Q: What is the name of the nucleotide sequence that helps the 30S ribosomal (small) subunit find the…
A: Translation initiation proceeds through the capture of mRNA by the 30s ribosomal subunit in…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: Answer : glycine, proline, alanine, arginine, The possible codons can be CCG CGC GCC GGC GCG CGG
Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…
A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…
Q: The template strand of wild-type gene A is shown below. On the space provided, type the translation…
A: Amino acids are known as the building blocks of protein. They are required for the synthesis of…
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…
A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…
Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…
A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…
Q: A small section of bacterial DNA template (anti-sense) strand has the following nucleotide…
A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…
Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…
A:
Q: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of…
A: Template DNA sequence - 5’-CGATTACTG-3’ After transcription the sequence - GCUAAUGAC Explanation -…
Q: The transcribed portion of a DNA sequence for a gene is shown below. Identify the MRNA sequence and…
A: The procedure of determining the order of the four nucleotide bases (adenine, thymine, cytosine, and…
Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write…
A: The coding strand is complementary to the template strand. The template strand is the DNA sequence…
Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…
A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…
Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…
A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…
Q: Fill in the complementary DNA strands for the DNA strands below Which nitrogen base CAN'T you use…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Given a non-template strand with this sequence: 3'- G CATCGCTAGCGGCTAGA-5' What will be the sequence…
A: The Maij difference between DNA and RNA is that DNA have bases A, T, G ,C where as RNA has A,U,G,C.…
Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…
A: Option 1 i.e. 5' AUA 3' is the correct answer.
Q: Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: A DNA molecule is a double-helical structure.
Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: During initiation of translation, a is positioned first at the…
A: The translation is the process of synthesis of proteins that occurs on the ribosomes in the…
Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…
A: DNA replication is the process by which a single DNA strand will produce two identical daughter…
Q: A mRNA strand is 5’ to 3 across the translation initiation complex. The start codon is ____ And…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: If the following piece of DNA were used as a template for transcription, what would the sequence of…
A: Transcription the process in which RNA is formed out of the DNA the processing that is translation.…
Q: Arrange the following components of translation in the approximate order in which they would appear…
A: Translation is the process of synthesis of proteins from the mRNA using special type of RNA called…
Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…
A:
Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…
A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…
Q: The MRNA produced when the following sense strand DNA sequence is transcribed is: 5'-…
A: The transcription unit is the segment of DNA that takes part in transcription. It is studied under…
Q: Need help to answer the following questions. Not sure if my answers are right.
A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…
A: DNA replication is the process of generating two identical copies from the original DNA strand. The…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…
Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC
A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…
Q: A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this…
A: During transcription, DNA information is transcribed into messenger RNA, which is then used to…
Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…
A: AAG ATA CAG GCT CGG TAA : DNA
Q: Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a.…
A: Nucleotides The bases found in the molecules of DNA are known as nucleotides. They are the building…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: Given Sequence:
A: The genetic information stored in a cell is transcribed into a messenger RNA by the process of…
Q: The following sequence is from the template strand of a bacterial gene, and it includes the…
A: According to the central dogma of the molecular theory, the information stored in DNA is first…
Step by step
Solved in 2 steps with 2 images
- The template strand of wild- type gene A is shown below. On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' TCAACGACTCTACCCTTTGCAAGAGGGCAT 3'On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
- Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’Provide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5'-AUUACGGUCUAU. Be sure to label the 5' and 3' ends.