The template strand of wild-type gene A is shown below. On the space provided, type the translation product of wild-type gene A (use three-letter abbreviation for the amino acids; use - to indicate a peptide bond).

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: Molnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA…

A: Mutations are sudden changes in the genetic material which can be either DNA or RNA.Molnupiravir is…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: Write the base sequence of the DNA template from which this RNA sequence was derived: UGUUACGGA. How…

A: Transcription  Cellular process in which RNA is synthesized using DNA as a template known as…

Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…

A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.  The alpha…

Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…

A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…

Q: Which letter in the image represents the end product and the process of translation

A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: For the following sequence please design an 18 base pair forward primer.  ATG TCA AAA GCT GTC GGT…

A: Introduction :  Primers are short oligonucleotides that are chemically synthesised and complementary…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: For the following sequence please design an 18 base pair REVERSE primer.  ATG TCA AAA GCT GTC GGT…

A: Primers are short single-stranded nucleic acid sequences that bind onto template strands and added…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence is…

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: following sequence please design an 18 base pair REVERSE primer.

A: Primers are short synthesized single-stranded sequences that bind onto the DNA strand by forming…

Q: identify the type of DNA binding motif is shown and the characteristics.

A: DNA stands for deoxyribonucleic acid. A DNA-binding domain consists of a structural motif that…

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: The mass of RNA that has copied a segment of DNA is 63,000 units. The RNA mass that is placed in the…

A: Here, first we have to calculate the RNA units that will be used for peptide synthesis  so, 60% 0f…

Q: From the results of your BLAST search you can link to the GENE entry for one of your top hits. This…

A: I do not have access to the specific BLAST results you are referring to. However, I can provide…

Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…

A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…

Q: Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide…

A: Given : Ser-Gly-Lys-Glu-Gly-Lys-Lys 1 amino acid : 3 codons 7 amino acids : 7×3= 21 codons

Q: The following amino acid sequence is found in a tripeptide: Met-TrpHis. Give all possible nucleotide…

A: each amino acid has a specific set of codons for their coding on the mRNA. the mRNA is the exact…

Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.

A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…

Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…

A: Transcription is the process of the formation of RNA from DNA. DNA contains nucleotides with…

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: The two complementary strands that run antiparallel to one another make up the DNA double…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: For the following sequence please design an 18 base pair forward primer.…

A: >> To make a primer, the pairing of bases goes as follows: A binds with T and T binds with A G…

Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…

A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Protein structure: Each layer of a protein's structure, which includes multiple different layers,…

Q: A standard codon table such as the one that we looked at in class gives the following information:

A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.