Which of the strands of DNA could act as a PCR primer for the DNA sequence shown below? 5’-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3’ 3’-GGGACCCGAGACATTTACAAAGATTCAC-5’   A. 3′-ACTGTTAGA-5′   B. 3′-AAATTTGGC-5′   C. 3′-ATGCTTTGA-5′   D. 5′-GGGACCCGA-3′   E. 5′-CCCTGGGCT-3′

a. what is the nucleotide sequence of the DNA chain synthesized from the primer. label the 5' to 3' ends b. what is the nucleotide sequence of the DNA chain use as the template strand. label the 5' and 3' ends c. write out the nucleotide sequence of the DA double helix (label the 5' and 3' ends)

A. In the product, the underlined regions are called what? B. What functional groups are present in the highlighted 5' and 3' ends of the DNA products?

The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP Pentanucleotide trinucleotide mononucleotide Dinucleotide Hexanucleotide Octanucleotide tetranucleotide Heptanucleotide nonanucleotide What is the sequence of the template DNA? A. 3'-GAGTTCAGC-5' B. 5'-GAGTTCAGC-3' С. 3-СТСААGТCG-5' D. 5-СТCААGТCG-3' E. 5'-CUCAAGUCG-3'

Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer?   a. 5’ – CAGAGATCGC – 3’   b. None of these sequences would represent the reverse primer   c. 5’ – GTCTCTAGCG – 3’   d. 5’ – GCGATCTCTG – 3’   e. 5’ – CGCTAGAGAC – 3’

DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC TTT GCA TTA 5' The DNA strand that is capable of forming a hairpin loop

RNA transcripts are formed in the   A. 3' to 5' direction by the RNA polymerase reading the DNA template in the 3' to 5' direction   B. 5' to 3' direction by the RNA polymerase reading the DNA template in the 5' to 3' direction   C. 5' to 3' direction by the RNA polymerase reading the DNA template in the 3' to 5' direction   D. 3' to 5' direction by the RNA polymerase reading the DNA template in the 5' to 3' direction

Write the sequence of a strand of DNA replicated using each of the following base sequences as a template: a. T C G A G A A T C T C G A T T b. C C G T A T A G C C G G T A C c. A T C G G A T C G C T A C T G

Which DNA strand is complementary to this template strand: 5’-GACGCT-3’? A. 5’-AGCGTC-3’ 3’-AGCTAG-5’ 5’-GACGCT-3’ 3’-GATCGA-5’ 5’-UCGAUC-3’   Which mRNA strand is transcribed from the above template DNA strand (the original)? 5’-GAUCGA-3’ 3’-CUGCGA-5’ 5’-CUAGCU-3’ 3’-TCGATG-5’ 5’-AGUGUC-3’   Which tRNA anticodon is complementary to the first mRNA codon (above)? 5’-GAU-3’ 3’-UAC-5’ 5’-AGC-3’ 3’-CGU-5’ 5’-GCU-3’

A scientist wants to amplify a short region of the DNA molecule shown below inside the box. Pick the PAIR of primers that can be used in a polymerase chain reaction (PCR) to amplify this fragment 5'TCTTCAAATGTCATCAAAGTGCCACTAGAAAAGAACTCATCGAATACTGAACAACTGTTAAAAAAGCAAAAAATTCTAA 3'AGAAGTTTACAGTAGTTTCACGGTGATCTTTTCTTGAGTAGCTTATGACTTGTTGACAATTTTTTCGTTTTTTAAGATT 5' CAGTTGTT 3' 1. 2. 5' GTTCTTTT 3' 5' AAAAGAAC 3' 3. What is the sequence of 5' TAGAATTT 3' 4. the primer that initiates synthesis of the bottom 5' AACAACTG 3' 5. strand of the indicated DNA region? 5' CAAATGTC 3' 6. What is the sequence of the primer that initiates 7. 5' GTTTACAG 3' synthesis of the top strand of the indicated 5' TTTTCTTG 3' 8. DNA region? 9. 5' TTGTTGAC 3' 5' GTCAACAA 3' 10. 11. 5'ATCTTAAA 3'