A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that corresponds to the DNA sequence above?

The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at the bottom”) of a segment of double helical DNA contains the sequence (5′) TCCGCTCCATCG (3′). What is the base sequence of the mRNA that can be transcribed from this strand?

For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?

Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5’-3’.

The following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.

If the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in? How many amino acids will the protein consist of?

Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the following polypeptide. The signal “!” means a stop codon:MYCATEATMYRING!