Create concept map DNARNATriplet codonTranscriptionTranslationReading framemRNARNA polymerasePromotorTATA boxStart codonRNA processing5' cappoly A tailintronexonsnRNPspliceosomeTranscription factors Stop codonTranscription initiation complexRelease factortRNAanticodonaminoacyl-tRNA synthetaseribosomal RNAE-siteP-siteA-siteinitiationelongationterminationpolyribosomeSmall ribosomal subunitLarge ribosomal subunitTerminator sequenceProtein

Name: Create concept map DNARNATriplet codonTranscriptionTranslationReading
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Create concept map DNARNATriplet codonTranscriptionTranslationReading framemRNARNA polymerasePromotorTATA boxStart codonRNA processing5' cappoly A tailintronexonsnRNPspliceosomeTranscription factors Stop codonTranscription initiation complexRelease f

Introduction DNA is a double-stranded molecule with a lengthy sequence of nucleotides. A…

Science

Biology

DNA RNA Triplet codon Transcription Translation TATA box Start codon RNA processing 5' cap poly A tail intron Reading frame mRNA RNA polymerase Promotor Transcription factors Transcription initiation complex Release factor exon snRNP spliceosome Stop codon tRNA anticodon aminoacyl-tRNA synthetase ribosomal RNA E-site P-site A-site initiation elongation termination polyribosome Small ribosomal subunit Large ribosomal subunit Terminator sequence Protein

DNA RNA Triplet codon Transcription Translation TATA box Start codon RNA processing 5' cap poly A tail intron Reading frame mRNA RNA polymerase Promotor Transcription factors Transcription initiation complex Release factor exon snRNP spliceosome Stop codon tRNA anticodon aminoacyl-tRNA synthetase ribosomal RNA E-site P-site A-site initiation elongation termination polyribosome Small ribosomal subunit Large ribosomal subunit Terminator sequence Protein

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 3P: Substrate Binding by RNA Polymerase RNA polymerase has t binding sites for ribonucleoside...

See similar textbooks

Similar questions

SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A
TATA TATAAT ATG STOP codon(s) AGGAGG CCUCCU ACCATEG GACA NAMENNI KEHIAKET III 11 11 11 11 Universal START codon Anti-Shine-Dalgama sequence found on ribosome Shine-Dalgamo consensus sequence Prokaryotic motif for RNAP RNA transcription termination motif downstream of STOP codon where CPSF binds Kozak consensus sequence Eukaryotic motif upstream of TATA Eukaryotic motif for RNA pol TAA and TAG and TGA Prokaryotic motif upstream of TATAAT
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
Biol 1406-Lec 17 - Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Question completion Status. Blackboard Learn Which of the following stater X 9. Which of the following statements about transcription is not true? In both prokaryotes and eukaryotes, pre-mRNA is modified after transcription by adding a 5' cap and a 3' poly-A tail and splicing out introns leaving coding exons. Paraphrasing Tool - QuillBot Your disk is almos Save space by optir O During transcription only one DNA strand called the template strand is read and rewritten by RNA polymerase with the template strand read in the 3' to 5' direction and the mRNA transcript synthesized in the 5' to 3' direction. O During initiation of transcription, RNA polymerase binds to the promoter region in the DNA, unwinds the DNA and binds together RNA nucleotides complementary to the template DNA strand. O During initiation of eukaryotic transcription, the promoter region contains a TATA box in which transcription…
3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.
otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit
ATTTGAGCC- OriginalATTGAGCC - Mutated The example above is an example of a Nonsense Deletion- Substitution Insertion- Frameshift Deletion -Frameshift
me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…