5' 2. Explain what indicates the beginning of translation, and what tRNA's role is in translation. How does the polypeptide form in relation to the A Site, P Site, and E Site found in the ribosome complex? Use the diagram to help explain your understanding of this process. ✓✓✓VV tRNA mRNA BOOLE 3' 5' mRNA 3' 5' mRNA 3'

Explain the interactions of specific tRNA with its synthetase, by including the importance of cloverleaf structure of tRNA, which domains are involved, distinct recognition sites, D-arm, TψC arm, anticodon loop and stem, linkage, activation, amino acceptor arm, ensuring the correct tRNA to be recognized by its synthetase.   Please do not answer with an incredibly long reply. I would just like the most condensed answer possible by providing all key points asked about. Thanks!

codon:         1       2     3      4      5       6      7 sequence: TAC ATG GAC AAT GAT TAG GGG   1. What is the sequence of the peptide that would result following translation with a ribosome?     Write your answer like this Met Ala Gly......   2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ?    Use the codon numbers to help describe where the mutation is located   . What mutation(s) would eliminate peptide translation?   Use the codon numbers to help describe where the mutation is located

Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? [Select] • Which position shows the "A" position? [ [Select] • Which end of the RNA is the 5' end? [Select] • Which base of the anticodon "AUC" (shown in the diagram) is the 5' end? [Select] CAG GAUCAUCGUCUAGAUUGCACAAU