Initiation of translation in E. coli requires:   Question 26 options:   methionyl-tRNA   60S Ribosomal subunit   40S Ribosomal subunit   Kozak sequence   mRNA

Q: For each, choose either replication, transcription, or translation. Okazaki fragment [ [ Choose ]…

A: The three main processes of central dogma of molecular biology are replication, transcription, and…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: Now, describe in detail the elongation phase of translation.

A: After initiation the ribosome continues sliding towards the 3' end of the mRNA template. It…

Q: Explain how the use of radiolabeled aminoacids in this procedure helped to reveal the genetic code.

A: Introduction  In 1964, two eminent scientists Marshall W. Nirenberg and Philip Leder carried out the…

Q: Demonstrate the consequence on following translation of the insertion of an adenine base to the…

A:

Q: Which site of ribosome does the initiator methionine-tRNA locate upon when it reaches the end of the…

A: Whenever required, large ribosomal subunit comes along with mRNA, initiator tRNA and small ribosomal…

Q: (question from a test) Some post-translational modifications have the function of linking the…

A: Post-translational modifications are defined as the covalent chemical modifications made to proteins…

Q: QUESTION 12 The images shown depict the initiation and elongation steps in protein translation. P.…

A:

Q: How does initiation of translation occur in prokaryotes? Include a discussion of the ribosomal…

A: Like transcription, the process of translation also involves three successive stages- initiation,…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Question 1: Define and give an example of the following: Codon, Start Codon, Anticodon, and Stop…

A: In molecular biology,  translation is the process by which the data stored in mRNA is converted into…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: What is not true about the difference between translation in prokaryotes and eukaryotes? O in…

A: mRNA (messenger ribonucleic acid) is a type of RNA that carries genetic instructions from DNA to the…

Q: definition for this question A,B,C, or D ?

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Translate the following mRNA sequence into the appropriate amino acid sequence.…

A: Messenger RNA is referred to as mRNA. It is a specific kind of RNA (ribonucleic acid) molecule that…

Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…

A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…

Q: How are introns recognized by snRNPs? Question 17 options: CTD of RNA polymerase II binds to…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: Please draw and explain translation dna synthesis

A: DNA is a self replicating molecule. The process by which mRNA is produced from DNA is called…

Q: 19. For this question, you will need to use the table for the genetic codes provided on the…

A: From DNA , mRNA is formed and use DNA strand as a template. Produced mRNA goes to cytosol and…

Q: Describing Functions: Building Vocabulary Skills In your own words, define each of the following in…

A: Translation process takes place in the cytoplasm of the cell. It involves tRNA, mRNA, large and…

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: in the endoplasmic reticulum and Golgi-complex, the determination of proper folding depends on what…

A: One of the most important post-translational modifications of proteins, protein glycosylation has a…

Q: The figure provided in in the introduction above shows adenine being deaminated to form the…

A: Wobble hypothesis - is about the base pairing between nitrogen bases in 1st and 2nd positions of the…

Q: GQ15

A: The image you sent is related to alternative splicing, which is a process that removes certain parts…

Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…

A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…

Q: If the anticodon of an alanyl-tRNA is IGC (inosine-guanine-cytosine), to which of the following…

A: In order to answer this question, we must be familiar with Wobble hypothesis. We know that the mRNA…

Q: (THIS IS NOT GRADED.) This is NON-MANDATORY homework for a practice assessment. I need some…

A: Translation what is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: phosphorylation

A: The activated PKA enters in to the nucleus and promotes the binding of Phosphorylated  CREB to a CRE…

Q: Is N-formyl-methionine used to start translation in eukaryotes? Yes No

A: Translation is the process in which ribosomes synthesize proteins after the process of transcription…

Q: The following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II into a…

A: Identify the 5' and 3' ends of the DNA template strand.  Write down the complementary bases for each…

Q: True or false: A fully assembled 70S ribosome is recruited to the mRNA just 5 ́ of the translation…

A: The translation begins with the attachment of messenger ribonucleic acid (mRNA) with the ribosome.…

Q: Match the eukaryotic rRNA molecules with the proper ribosomal subunit. 55 FRNA [Choose ] 5.8S rRNA…

A:

Q: QUESTION 4 What is the name for the complex that forms when many ribosomes translate the same MRNA…

A: The name of complex that forms when many of ribosomes translate the same mRNA at same time is called…

Q: The synthesis of a protein requires that the amino acids that constitute the growing polypeptide…

A: In the intricate dance of cellular processes, protein synthesis takes center stage, orchestrating…

Q: Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to…

A: The Central dogma of molecular biology involves the synthesis of RNA using DNA as template by the…

Q: The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the…

A: Shine-delgrano sequence in mRNA is essential for the binding of prokaryotic ribosomes to carry out…

Q: The antibacterial protein colicin E3 is an effective inhibitor of pro- tein synthesis in…

A: It is given that the protein colicin E13 is an effective inhibitor of the protein synthesis in…

Q: Question 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need…

A: Introns -- Introns are described as nucleotide sequences in DNA and RNA ,do not directly code for…

Q: Please write primary amino acid sequence with minimum number of amino acids that leads to formation…

A: The primary amino acid sequence  is simply the linear arrangements of amino acids that make up that…

Q: In the absence of cladosporin, explain the elongation steps in the synthesis of lysyl-tRNA…

A: DNA is the preferred carrier of genetic information in almost all organisms barring RNA viruses. DNA…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Before the next elongation cycle can take place at a ribosome, the peptide chain of the…

A: In the intricate process of protein translation, ribosomes orchestrate the synthesis of vital…

Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…

A: The central dogma of life involves three major steps that include: DNA replication: This is the…

Q: The antibacterial protein colicin E3 is an effective inhibitor of protein synthesis in bacteria.…

A: Colicin E3 has a bactericidal effect. It is made and released by E.coli cells to act on other E.coli…

Q: Please help me complete this solution, i cant figure out what is incoorect about this statement...…

A: The protein is a principal component of the entire cell. It is an organic compound that is made of…

Genetic Recombination

Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.

Microbial Genetics

Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.