Please draw and explain translation dna synthesis

GCT GAC ATC CTC CTC mutated DNA sequence           mutated mRNA sequence           mutated amino acid sequence Above is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.

Use the DNA sequence above, list all possible splicing products

Origin of replication [ Choose ] [Choose] Codon Complementary pairs with cytosine in a DNA molecule The site of protein synthesis Ribozyme This molecule can begin the synthesis of a polymer of nucleotides without a primer A short peice of lagging stand DNA Primase A reflection of redundancy in the genetic code RNA which exhibits enzymatic properties Okazaki Fragment The process of making RNA from DNA Helicase DNA polymerase Transcription Enzyme which lays down a segment of RNA on replicating DNA so that DNA nucleotides can polymerize A sequence of three nucletotides which codes for an amino acid Ribosome Point Mutation Chromosome Wobble Position The point on a stand of DNA where replication begins Mitochondria RNA polymerase [ Choose ] Guanine

During translation, the formation of peptide bonds between adjacent amino acids requires peptidyl transferase enzyme activity, which is carried out by ______________________.   Release Factor 23S rRNA of the large ribosomal subunit 16S rRNA of the small ribosomal subunit tRNA A protein enzyme called peptidyl transferase

More than one answer can be correct

Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts. Be sure to include the name of the protein-ribonucleotide complex that’s involved.

- Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA.

Match the statement that corresponds to the specific type of transcription and translation. Choices: Eukaryotic Translation Prokaryotic Translation and Transcription Both Prokaryotic and Eukaryotic Transcription Prokaryotic Transcription Prokaryotic Translation Both Prokaryotic and Eukaryotic Translation Eukaryotic Transcription 1. RF1 and RF2 recognize the three bases to terminate the process 2. TATA box in the promoter region 3. single mRNA codes for the proteome 4. methionine is removed 5. simultaneous and rapid process producing mRNA and polypeptide 6. eRF recognizes UGA  7. dozen of initiation factors involving methionyl tRNA * 8. rho factor and sequence of uracil in a loop conclude the process 9. ribosome propels to the next bases  10. sigma factor binds to RNA polymerase in the promoter region 11.  regulating elements in the operon  12. cleaving the polypeptide by adding water 13. removal of gene segment disrupting the message 14. CAAT box is found 80 nucleotides from the…

State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included)                +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA