In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of amino acid in the protein formed by this mRNA molecule?

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp…

A: Need to find the mature mRNA in above options

Q: All of the following mRNA codons signal the end of translation, in both prokaryotes and eukaryotes,…

A: The translation is a molecular process of synthesis of protein from genetic information encoded in…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: What function do the 5' cap and the poly-A tail serve on a eukaryotic mRNA?

A: DNA is a long polymer of deoxyribonucleotides. It is an acidic substance present in the nucleus,…

Q: Which of the following types of RNA is involved in pre-mRNA splicing?

A: For eukaryotic genes and some prokaryotic genes, the initial RNA which is transcribed from a genes…

Q: Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the following?…

A: Ans:-C 1.What end does the poly A tail attach to? 3′ end A poly (A) tail is added to the 3′ end of…

Q: What mRNA is most obviously essential in coding proteins, list and describe two classes of…

A: RNA is an intermediate between DNA and proteins.

Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Q: In bacterial genes, as soon as any partial mRNA transcript is produced by the RNA polymerase system,…

A:

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’  If there are…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: A certain gene in a bacterium codes for a polypeptide that is 400 amino acids long. How many…

A: Introduction  Short strands of amino acids connected by peptide bonds are called peptidides.…

Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?

A: Introduction :- In molecular biology , different processes of gene expression is studied , these…

Q: what is c-abl mRNA

A: An mRNA is the RNA encoded from a stretch of DNA template strand to serve as a template for the…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3.  What…

A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: Which of the following is least likely following translation termination? The polypeptide is…

A: Introduction: Translation of termination is process in  which the genetic code is  within a…

Q: Which of the following is not something commonly associated with eukaryotic MRNAS? 1. Splicing of…

A: Messenger Ribonucleic acid [m-RNA] is formed inside the cell by the process of transcription. The…

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNAs…

A: The biological mechanism by which messenger RNA is translated into proteins in eukaryotes is known…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: . What mRNA base sequence would be obtained from the following portion of a gene?

A: Genetic information is transferred from genes to the proteins via messenger RNA.…

Q: In prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated,…

A: Methionine which is a central molecule in one-carbon metabolism is an essential amino acid needed…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: What role does the poly(A) tail play in mRNA function?

A: Polyadenylation is a process in which poly (A) tail is added to the 3' end of the newly synthesized…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: What are two advantages for circularizing the mRNA during the process of eukaryotic translation?…

A: Thank you for the question  Answer The two advantages for circularizing the mRNA during the process…

Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…

A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…

Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…

A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: What would be the tRNA anticodons for the mRNA in question 3

A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .

Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'   As following the rules in Genetic code the…

Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid?  a. E b. K c.F d.L

A: Dear student answer of your question is given below:  Given codon in the mRNA is 5' GAA 3' ,  It…

Q: Eukaryotic mRNA has a significantly longer half life than its prokaryotic counterpart. How is this…

A:

Q: Assume that the following mRNA segment has been translated.   5’-UACCGAAUGUCU-3’   Note for…

A: Translation is the process during which codons in mRNA are identified by tRNA with specific…

Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…

A: Mature mRNA or mature transcript is the RNA present in eukaryotes  which consists of exons with all…

Q: Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this…

A: Messenger (mRNA) ribonucleic acid helps in the formation of protein as it contains the long base…

Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…

A: Introduction  DNA and RNA are the main genetic material found in all the species irrespective of…

Q: Identify the different regions of the mature mRNA by matching terms with regions. regions are shown…

A: Answer. Eukaryotic m RNA are mostly monocistronic having an average size of 1500 to 2000…

Q: Prokaryotic mRNAs have a RBS (Ribosomal binding site). How they use RBS for translational machinery?…

A: Translation is synthesis of protein from the m-Rna and this occurs in the cytoplasm as all the…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…

Q: How and why do prokaryotic mRNA and eukaryotic mRNA differ?

A: mRNA or messenger RNA is a nucleotide molecule that carries information from the DNA to form…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.