Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ If there are multiple possible start codons, how can you identify the original start codon? Explain. Your Answer:
Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ 1 ⦁ If there…
A: DNA to RNA is transcription and RNA to protein through tRNA anticodon gives a protein sequence.
Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…
A: In eukaryotic organisms, the gene contains introns as well as exons. Eukaryotic genomes are much…
Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…
A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: The transcription is intended to generate an RNA copy of the DNA sequence for the gene. The RNA…
Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…
A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A:
Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…
A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…
Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…
A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…
Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…
Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…
A: BASIC INFORMATION GENETIC CODE These are the codes which helps in the formation of the protein…
Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Which of the following feature of mature mRNAs protects them from premature degradation by cellular…
A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that matches to a…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…
Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…
A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…
Q: What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that…
A: Base sequence of mRNA Amino acid sequence UUG LEUCINE CCU PROLINE AGU SERINE GAU ASPARTIC…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…
Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…
A: Option 1 i.e. 5' AUA 3' is the correct answer.
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…
Q: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your…
A: Rho utilization site , also known by the acronym rut is a sequence of RNA in bacteria upstream of…
Q: When examining the genetic code, it is apparent that ________. there are 44 stop codons…
A: The process of polypeptide chain synthesis or protein synthesis is known as translation. By this…
Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…
A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…
Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…
A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…
Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ This is an mRNA…
A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…
Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…
A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…
Q: The sequence of a segment of mRNA, beginning withthe initiation codon, is given here, along with the…
A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…
Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…
A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: The amino acids are coded by the group of three bases called base triplets and codons.
Q: ook at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the…
A: Note- According to the guidelines, only the first three questions can be answered out of MCQs.…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…
Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…
A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…
Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'
A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' As following the rules in Genetic code the…
Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for…
A: Translation is the process during which codons in mRNA are identified by tRNA with specific…
Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…
A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…
Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…
A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…
Q: Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A.…
A: The RNA molecule is made up of four nucleotide bases: adenine (A), cytosine (C), guanine (G), and…
Q: Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for…
A: The exons are the type of sequences that are utilized after the processing of the mRNA is complete.…
Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…
Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…
A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.
Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…
A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…
Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…
A: Translation It is the synthesis of proteins from the codons present in the mRNA. Anticodons…
Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…
A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…
Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…
A: Introduction The central dogma of molecular biology describes the flow of genetic information from…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…
⦁ Following is an mRNA sequence reported in data base.
5’ ACC AGA ATG ACC ATG GCA 3’ If there are multiple possible start codons, how can you identify the original start codon? Explain.
Your Answer:
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC⦁ Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ 1 ⦁ If there are multiple possible start codons, how can you identify the original start codon? Explain.Your Answer: 2. 5’ ACC AGA ATG ACC ATG GCA 3’ This is an mRNA sequence, but why there are T’s instead of U’s? Explain.Your Answer:
- Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysFirst Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
- mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
- ⦁ Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ ⦁ There are two ATG’s. From which the translation can be initiated.⦁ 1st ATG⦁ 2nd ATG⦁ None⦁ If there are multiple possible start codons, how can you identify the original start codon? Explain.Your Answer: ⦁ This is an mRNA sequence, but why there are T’s instead of U’s? Explain.Your Answer:mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.