Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
Bartleby Related Questions Icon

Related questions

Q: Explain the term polycistronic mRNA.
A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…
Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…
A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…
Q: List and draw out four distinctive features of most eukaryotic mRNAs.
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Bacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated…
A: The transcription in prokaryotes is either terminated by rho-dependent or rho-independent process or…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG
Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…
A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…
Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…
A: Option b
Q: Since among the 64 codons of mRNA 61 codify amino acids that form polypeptide chains what are the…
A: From the above given question we have to show what are the three functions of remaining codons as…
Q: Please describe the four-step process of the elongation during protein translation in bacteria.
A: Translation is  the process of formation of proteins from mRNA with the help of ribosomes in the…
Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…
A: Hemophilia -- It occurs in about 1 of every 5000 males .     Usually a inherited disorder in which…
Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…
A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…
Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…
A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.
Q: The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to…
A: Genetic code is a triplet code that consist a set of three nucleotide bases, known as codons. Each…
Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…
A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…
Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…
A:
Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: Transcription is the process in which RNA is synthesized from DNA.
Q: A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species…
A: Trinitrotoluene (TNT), a solid organic nitrogen chemical that is mostly utilised as an explosive and…
Q: A mini mRNA has the sequence 5'UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3'.  a) Use the genetic code to…
A: Messenger RNA (mRNA) is a type of single-stranded RNA (ssRNA) involved in protein synthesis. mRNA is…
Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…
A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…
Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…
A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…
Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…
A: Alternative splicing is a method through which a messenger RNA may control the creation of many…
Q: double-stranded helix
A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…
Q: How can you identify the start codon in the mRNA sequence ?
A: mRNA sequence During the process of translation, mRNA is read on the basis of genetic code that…
Q: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately…
A: The translation is the process of producing protein mRNA as a template and peptidyl activity of the…
bartleby

Concept explainers

Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of anoth…
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Topic Video
Question

A certain gene in a bacterium codes for a polypeptide that is 400 amino acids long. How many nucleotides are needed in the mRNA to code for this polypeptide?

Expert Solution
Check Mark
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
bartleby
This is a popular solution
See solutionCheck out a sample Q&A here
Step 1
VIEW
Step 2
VIEW
bartleby

Trending nowThis is a popular solution!

bartleby

Step by stepSolved in 2 steps

See solution
Check out a sample Q&A here
Blurred answer
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
SEE MORE TEXTBOOKS