Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар Exon 1 Exon 2 Exon 3 | Exon 4 АAAAААА АAAAAАААААААААА 3" F E 5'UTR F 3' UTR Coding sequence A Poly-A tail în
Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ 1 ⦁ If there…
A: DNA to RNA is transcription and RNA to protein through tRNA anticodon gives a protein sequence.
Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…
A:
Q: Match Column A with Column B. |Intron is removed from the MRNA transcript A 1st event v MRNA is…
A: Transcription is the mechanism by which mRNA is produced from template DNA in molecular biology. As…
Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…
A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…
Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: How many bp in length is the fully processed MRNA if it contains a 50 bp poly A tail. Draw the fully…
A: DNA and RNA differ in only one of the four nitrogenous bases. RNA has uracil instead of thymine. DNA…
Q: A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that…
A: The normal mRNA is 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ The bases in bold form the start codon.…
Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?
A: Introduction :- In molecular biology , different processes of gene expression is studied , these…
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What…
A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…
Q: B. A polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA…
A: Introduction DNA resides in the sequence of four nucleotides. The genetic code is a triplet code…
Q: An mRNA has the following sequence: 5′–AUG UAC UAU GGG GCG UAA–3′ Describe the amino acid sequence…
A: mRNA is a single-stranded RNA molecule that is complementary to one of the DNA strands of a gene. It…
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…
A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…
Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…
A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…
Q: Interaction between and of the mRNA is required for…
A: The genetic code embedded in a messenger mRNA molecule is translated to generate a particular…
Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…
A: An open reading frame in molecular genetics describes the part of your reading frame that has the…
Q: 6. How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce? (LS1-1) * Second MRNA…
A: The translation is the process by which the information on the mRNA is transferred into appropriate…
Q: When MRNAS are edited to become mature mRNA, the nonsense regions that are removed are called and…
A: Ribonucleic acid (RNA) is a significant organic macromolecule that is available in all natural…
Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…
A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…
Q: Which amino acid would bind if the mRNA read.... AGG? Ala (A) Ser (S) G A Lys (K) Asp (D) U ← Asn…
A: Once mRNA is produced, by transcribing and processing the information contained in the nucleotide…
Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *
A: Amino acids production.
Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…
A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.
Q: AG Codons: a. MRNA 5'1 3' Amino acids: с. d.
A: Transcription is the process by which RNA synthesized with the help of the DNA and translation is a…
Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…
A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…
Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…
A: ANSWER - in this figure the following sequences are not directly transcribed from the template…
Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…
A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…
Q: As opposed to DNA replication or transcription, translation requires the correct reading frame.…
A: A double-stranded DNA molecule can read in any of six possible reading frames- three in the forward…
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…
A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…
Q: Consider the following gene with their respective introns and exons 5’ –…
A: Since you have asked multiple questions, we will solve the first three question for you. If you want…
Q: If the promoter is here and transcription starts here…
A: Transcription is the process of formation of RNA using DNA as a template.
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid…
A: We'll answer the first question since the exact one is not specified. Please submit a new question…
Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…
A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…
Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…
A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…
Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ This is an mRNA…
A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…
Q: C a 3' 5' exon intron exon intron exon intron untranslated region (UTR) coding sequence (CDS) Label…
A: Genes are the hereditary unit of an organism. It is inherited by the progeny from the parental…
Q: Which of the following help(s) to stabilize mRNA by inhibiting degradation? a. Introns b.…
A:
Q: ⦁ Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ ⦁ There are…
A: The process of translation is initiated by the start codon which is a nucleotide triplet situated in…
Q: What would the sequence of the immature mRNA be? Place the sequence of ALL the transcript that would…
A: Some genes do not synthesize protein by utilising the entire DNA sequence. Introns are non-coding…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: 5. A DNA sequence of "ACG" will code for the amino acid (LS1- 1) * Second mRNA base U UUU Phe UCU…
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…
A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…
Q: ow would you choose where to begin your reading fa sequence in MRNA? Which rule governing the se of…
A: The process of generating a polypeptide chain (protein) from an mRNA sequence is known as…
Q: If a stretch of mature mRNA to be translated has 300 bases, the resulting peptide will have O 300…
A: Amino acids are chemical molecules that contain the functional groups amine (NH2) and carboxyl…
Q: a) Examine the nudeotide sequence below, and determine the amino acid sequence encoded by this mRNA.…
A: a) The nucleotide and translated mRNA and amino acid sequences are given below: GGA GGC CTG GCC TAC…
Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…
A: AAG ATA CAG GCT CGG TAA : DNA
Q: Identify the different regions of the mature mRNA by matching terms with regions. regions are shown…
A: Answer. Eukaryotic m RNA are mostly monocistronic having an average size of 1500 to 2000…
Q: Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid…
A: DNA => Transcription => mRNA => Translation => Protein. Given DNA sequence: 5' ATG CTT…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: To find: To find the complementary base sequence and the corresponding mRNA sequence using the given…
7
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Quick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUU Phe UCU U UUC JUA UUG U CUA CUG Leu AUU A AUC lle AUA CUU CCU C CUC Leu CCC Pro CCA CCG UAU UCC Ser UAC UCA UAA UCG UAG ACU ACC Second Letter ACA AUG Met ACG C GUU GCU G GUC Val GCC GUA GCA GUG GCG AAU Thr AAC AAA AAG Ala CAU His CAC CAA Gin CAG GAU GAC A GAA GAG Tyr UGU Cys U UGC Stop UGA Stop Stop UGG Trp CGU CGC Arg CGA CGG Asn Lys Glu G AGA AGG Asp GGU Arg DCAG DCA AGU Ser U letter AGC GGC Gly GGA GGG A U VAG U JOJO 3rd G AlbGive the single letter translation for the protein encoded by this mRNA. Start with the start codon. 5' M7GPPP- CCGACGUAUAUGGCGACUGAUCACUGACCAACGAAAA O ATDHXPTK OPTYMATDH MRAHVT O MATDH AAAAAA - 3'5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
- Provide the abbreviation for the amino acid sequence expected from the following mRNA segment using the three-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’sTranslate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'
- Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of eachConsider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterSA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omiss
- Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCCWhich of the following polypeptides (written from their N terminal ends) is encoded by the following mRNA? (hint: there is no left or write in a cell!) 3' GG AUG AGU AUA CUU ACG GGU GAA GUA CAU UAA CCC C5' O O O Met Lys Trp Ala Phe lle Met Ser lle Leu Thr Gly Glu Val His Tyr Lys Arg Thr Phe Tyr Met none of the above His Val Glu Gly Thr Leu lle Ser MetWhat is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'