Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNA…
A: The process in which eukaryotic ribosome selects its start codon is a part of translation.…
Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…
A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…
Q: One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon…
A: Answer: Introduction: An anticodon means the three-base arrangement, paired with a specific amino…
Q: How is each tRNA charged with the correct amino acid? What are the consequences of a tRNA carrying…
A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…
Q: What two reaction steps are required for the formation of an aminoacyl-tRNA?
A: In molecular biology, translation is the cycle wherein ribosomes in the cytoplasm or endoplasmic…
Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: What is the molecular weight of an mRNA that codes for the protein of molecular weight 75000KD?…
A: The translation is a process in which protein gets synthesized from mRNA template. It occurs in 3…
Q: How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences…
A: The genetic information flows from the form of DNA into the form of protein and this framework is…
Q: How does it improve the efficiency of protein synthesis to have several binding sites for tRNA close…
A: Translation is the process by which a protein is synthesized from the information contained in a…
Q: Describe what is the function of the anticodon of a tRNA?
A: The biological instruction manual known as DNA, sometimes called deoxyribonucleic acid, provides…
Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…
Q: The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O…
A: Messenger RNA (mRNA): mRNA is a single-stranded RNA molecule that is complementary to one of the DNA…
Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…
A: Anticodon is a sequence of three nucleotides on a tRNA molecule that bind to a specific…
Q: Why must tRNA molecules have both unique structural features and common structural features?
A: An adaptor molecule that contains a certain AA (amino acid) to the “messenger ribonucleic acid”…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?
A: Codon is defined as the the group of three nucleotides that encode an amino acid.
Q: What is the minimum number of tRNA molecules that a cell must contain in order to translate all 61…
A: A transfer RNA is adaptor molecule composed of RNA having 76 to 90 nucleotides in length.
Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…
A: Transcription is the process in which mRNA (messenger RNA ) is made from DNA which further…
Q: What are the three functional parts of the tRNA and what is their importance to translation?
A: Transfer RNA or tRNA generally contains 76-90 nucleotides and acts as a physical link in between…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks…
A: Translation Translation involves the answer of information in mrna molecules into the amino acid…
Q: What role does the poly(A) tail play in mRNA function?
A: Polyadenylation is a process in which poly (A) tail is added to the 3' end of the newly synthesized…
Q: Give the anti-codon of this Trna?
A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…
Q: What is the significance (or function) of tRNA in protein synthesis? In other words, explain why…
A: transfer RNA or t RNA is a small RNA molecule that participates in the protein synthesis. each t RNA…
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…
Q: Why is it essential that tRNA binds to both amino acids & mRNA codon during protein synthesis?
A: Protein synthesis involves translation of mRNA into a protein that requires three complex stages,…
Q: If a tRNA anticodon is CAA what is its corresponding mRNA codon? For the genetic code which amino…
A: Genes that provide instructions for proteins are expressed in a two-step process i.e., by…
Q: If a mutation changed the start codon into a stop codon, would this mutation affect the length of…
A: Mutations are the changes in the base sequences of the nucleotides in a gene. They are known as gene…
Q: If a nonsense mutation can be suppressed by a tRNA mutation that changes an anticodon so that a…
A: Mutations are defined by any changes in the original DNA sequence caused due to insertions,…
Q: What is the function of the anticodon of a tRNA?
A: tRNA is basically a messenger molecule that helps in decoding of mRNA and helps in the formation of…
Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…
A: The central dogma of life involves three major steps that include: DNA replication: This is the…
Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…
A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…
Q: What would be the tRNA anticodons for the mRNA in question 3
A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .
Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Label the following regions on this tRNA molecule, stating the function of each:
A: This is a tRNA molecule. It has an amino acid arm where the corresponding amino acids bind. It has…
Q: . What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61…
A: The three consecutive nucleotides on messenger ribonucleic acid from codon. The codon sequence…
Q: Is the Aminoacyl tRNA synthetases in human cells specialized or non specialized? Explain.
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…
A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…
Q: In this picture, a tRNA is already bound to the initiator codon at the start of the mRNA strand. The…
A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…
Q: NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that takes role in the creation of…
Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…
A: The proteins are the fundamental biomolecules in the body and act as substrates, enzymes, and…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?…
A: We know that the mRNA carries the codon and the tRNA carries the anticodon. The transfer RNA is the…
Q: What would be the effect of a mutation that eliminated the downstream 3′ splice site at the end of…
A: In eukaryotes, genes are distributed in form of non-coding regions called introns and coding regions…
Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…
A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…
Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…
A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…
Q: Match each term with the most appropriate description. sites for polypeptide assembly binds to…
A: All cells have the translation process resides within a specialized organelle which is known as the…
Q: If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it…
A: An anticodon is a trinucleotide sequence that is complementary to that of a corresponding codon in…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- If the mRNA produced had the sequence ACGCGU,what would be the tRNA anticodo sequence?A tRNA has an anticodon sequence 3′– GGU–5′. Identify the amino acidit is carrying?Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
- A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GA peptide sequence is composed of 10 serine residues. Determine how many different mRNA sequences could code for the peptide.
- A nonsense mutation is a substitution mutation that creates a chain-terminating codon in the mRNA corresponding to the mutant gene. Identify three substitution mutations that could change a tryptophan codon to a nonsense triplet.A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon?Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
- A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is the sequence of the complementary mRNA strand? 3 po 2) What is the sequence of the coding DNA strand? 3) After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, write out the resulting amino acid sequence of the polypeptide after post-translational modification.One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon on the tRNA that carries phenylalanine?Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG. If the old protein sequence was Met-Thr-Arg-Leu-Leu, what will be the new sequence encoded by the mutant gene?