Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand.           tRNA    UAA  CCA  UUA  UAA                     mRNA  Amino Acids                                                                                     AUU = isoleucine

Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence.  5' CAA…

A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…

Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…

A:

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: All of the following mRNA codons signal the end of translation, in both prokaryotes and eukaryotes,…

A: The translation is a molecular process of synthesis of protein from genetic information encoded in…

Q: Use the bank of terms listed to label all important structures of the diagram of the translation…

A: According to the given translation complex diagram, the structures present are 131 - Polypeptide 132…

Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…

A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: Group of nucleotides that confers specificity for the appropriate aminoacyl-tRNA synthetase is…

A: tRNA  Transfer RNA or tRNA is help in the decoding of mRNA. It brings up the amino acid to the P…

Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…

A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’  If there are…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: Which of the following arms of t-RNA is required for recognition of the t-RNA by its proper…

A:

Q: Which of the following feature of mature mRNAs protects them from premature degradation by cellular…

A: Introduction  Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that matches to a…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…

A: DNA is the store house of genetic information. This information is in the form of nucleotide…

Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…

A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…

Q: What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that…

A: Base sequence of mRNA Amino acid sequence UUG LEUCINE CCU PROLINE AGU SERINE GAU ASPARTIC…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Which of the following is not involved in the elongation of prokaryotic peptide? a. EE-Tus, EE-Ts,…

A: The translation is the process by which protein is synthesized with the help of mRNA, tRNA, and…

Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…

A: Transcription is the process  in which mRNA (messenger RNA ) is made from DNA which further…

Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…

A: tRNA  It is a leaf like structure can has anticodon sequence at one end and attached amino acid on…

Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…

A:

Q: Given the template DNA sequence:  3’ - TAC - CAG - GTT - ACC - ATC - 5’    A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…

Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Which of the following amino acids is carried by the tRNA that initiates translation in eukaryotes?…

A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…

Q: peptide bonds between adjacent amino acids requires peptidyl transferase enzyme activity, which is…

A: The enzymatic activity of ribosome is called as peptidyl transferase activity. The site of catalysis…

Q: What amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met…

A: tRNA stands for the transfer RNA and it has L- shaped structure . Transfer RNA acts as an adopter…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: Which of the following RNAs are required for translation? (Choose all that apply) tRNA rRNA…

A: Adenine, guanine, cytosine, and uracil make up RNA, which is a polymer of nucleotides composed of a…

Q: Which of the following is the definition of a gene?   A. RNA that delivers amino acids to a ribosome…

A: Genetics is a science of the study of genes. It involves the identification of specific genes for…

Q: A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The anticodon of the tRNA is 3'-UAC-5', and it binds to a codon in an mRNA with the sequence…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…

Q: "Place the following prokaryotic translation events in order: translocation, binding of initiator…

A: The correct answer to this particular question will be, assembly of small and large ribosomal…

Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…

A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…

Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'   As following the rules in Genetic code the…

Q: Select all of the factors in the list below that play a role in the translation initiation of…

A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…

A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.

Q: In this picture, a tRNA is already bound to the initiator codon at the start of the mRNA strand. The…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: A mutation is found in a tRNA-encoding gene. The wild type allele produces a tRNA that recognizes…

A: The translation is a process by which the proteins are synthesized. Proteins are important for the…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: Which of the following are involved in transcription? Select all that apply a. rRNA b. DNA c.…

A: Transcription allows the formation of an intermediate between the DNA and the proteins which are the…

Q: codon

A: The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time…

Q: The mature m-RNA is capped by which of the following heterocyclic bases (or which of the following…

A: Transcription is a process through DNA is converted into mRNA.

Q: Enzymes in which the catalytic portion is not made of protein include all of the following except:…

A: Ribozymes (ribonucleic acid enzymes) are RNA molecules that have the ability to catalyze specific…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.