The mature m-RNA is capped by which of the following heterocyclic bases (or which of the following heterocyclic bases are present on the cap of a mature m-RNA? a. 5-methylcytosine b. 5-methyguanine c. 7-methylguanine d. 7-methylcytosine
Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…
A: Transcription is the initial stage in gene expression, when information from a gene is used to build…
Q: Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…
A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while…
Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…
A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…
Q: Once a peptide bond has been formed between the amino acid attached to the TRNA in the P site and…
A: To find The process what occurs next once a peptide bond has been formed between the amino acid…
Q: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA…
A: Correct answer is option... B. Translation stops and the protein is released
Q: During elongation (in transcription), RNA polymerase has three prominent channels, or grooves. These…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…
A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…
Q: Draw the structures of adenine and uracil (which replaces thymine in RNA), and show the hydrogen…
A: A nucleotide is defined as an organic molecule composed of a nucleoside and a phosphate group.…
Q: Which enzyme links amino acids to the 3’ OH group of an RNA? (a) ribozyme (b) peptidyl…
A: The translation is a process of converting mRNA molecules to amino acids which take place in the…
Q: Which of the following statements about RNA structure is FALSE? O A. A sequence in a tRNA that forms…
A: A transfer RNA is an adaptor molecule that is composed of RNA and serves as the physical link…
Q: A) Describe each step of the DNA REPLICATION in EUKARYOTIC organisms B) Describe each step of the…
A: Transcription = Re-writing DNA into RNADNA is "transcribed" or re-written into RNA in a very…
Q: . Which of the following descriptions of EF-Tu is correct? A. EF-Tu delivers fMet- RNA to the A site…
A: Introduction: Elongation factors deliver aminoacyl-tRNA to the ribosome. Ef-Tu is a monomeric…
Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…
A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…
Q: The “A” site in the ribosome refers to the: A. binding site for charged t-RNA molecules…
A: According to the question, we have to find out the function of the "A" site in the ribosome from the…
Q: amino acids are covalently linked to tRNAs via what a) phosphodiester bond b) premature…
A: Protein synthesis is governed by the genes which are present on the chromosomes. The genes are first…
Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…
A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.
Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…
A: Gene expression is the process by which the instructions in the DNA are converted to functional…
Q: The same DNA sequence may code for more than one polypeptide. Which one of the following is not used…
A: The pre-mRNA undergoes various rounds of processing so that it is ready for translation into a…
Q: The primary function of RF1 during translation is to: a. recognize a stop codon in the 70S A…
A: The translation is the process of translating genetic information in the form of proteins. It…
Q: What is one function of the 5' cap in eukaryotic mRNA? Select one: a. It is involved in translation…
A: Transcription is the process in which the RNA is synthesised from the DNA that is present in the…
Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…
A:
Q: In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A.…
A: Ribosomes are small and round bodies that are either found floating freely in the cytoplasm, or…
Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…
A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…
Q: GIVE A SHORT ANSWERS TO QUESTIONS GIVEN BELOW Why Phosphate bond is important in DNA or RNA…
A: Phosphate bond are important because structural framework of nucleic acid the energy for producing…
Q: In the triplet-binding assay of Nirenberg and Leder, an RNA triplet composed of three bases was able…
A: Introduction In 1964, two eminent scientists Marshall W. Nirenberg and Philip Leder carried out the…
Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: Transcription is the process in which RNA is synthesized from DNA.
Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…
A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'
Q: Which part of a tRNA molecule acts as an amino acid attachment site? a. the 5' end b.…
A: tRNA (transfer ribonucleic acid) molecule escorts amino acids to their correct location in a…
Q: Label the features of a tRNA by dragging the labels to the correct targets. A Binds an amino acid B.…
A: tRNA is also known as transfer RNA which helps in the transfer of amino acid to the mRNA codon…
Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…
A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…
Q: There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by…
A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…
Q: Determine which amino acid is formed from the following mRNA codon: GUA. a aspartic acid b…
A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…
Q: Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of…
A: In genetic code, the following terms have specific meaning. These are- 1. Unambiguous- Genetic code…
Q: Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same…
A: mRNA transcription and translation occurs at same time in prokaryotes(polycistronic) while in…
Q: The addition of the poly-A tail adds more than 200 units of adenine to the strand of mRNA, yet no…
A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…
Q: Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA…
A: Introduction: A significant class of ribonucleic acids is called transfer RNA (tRNA). During protein…
Q: Which translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome? A.…
A: The translation process is responsible for synthesizing the protein in the cytoplasm of the cell.…
Q: What happens immediately after the initiation complex forms during translation? (a) peptide bond…
A: Translation is biological process which involves protein synthesis with the help of mRNA i.e.…
Q: Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes…
A: Protein synthesis is the process where cells make proteins and occurs in two stages: transcription…
Q: The codon and anticodon are base-paired together during the process of translation. Which of the…
A: The central dogma of molecular biology involves the transfer of information from DNA to proteins…
Q: What molecule/feature ensures that the correct amino acid is added to the peptide chain with reading…
A: The process in which the mRNA is converted into the proteins buy the help of particular codon is…
Q: Which statement is true of the translocation phase of elongation during protein synthesis? a. The…
A: The translation is the process by which ribosome synthesis protein using mRNA. It consists of three…
Q: The release factors RF1 and RF2 are required for
A:
Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…
A: NOTE:- As you posted multiple parts under one question, we will solve the first three for you, to…
Q: . Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base…
A: A codon is the triplet sequence of DNA or RNA nucleotides which corresponds either to specific amino…
Q: hich of the following play an important role in synthesis of DNA/RNA: a.B-12 b.Folic acid c.Sodium…
A: DNA stands for Deoxyribonucleic acid is a helical, double-stranded molecule that serves as the main…
Q: . To attach to viral sequences b. To weigh down mRNA c. To terminate translation…
A: The purpose of a Poly-A tail being added to mRNA is to terminate translation. The polyA tail is a…
Q: Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3'…
A: In the yeast the poly (A) signal sequences are present which are short sequences and redundant in…
Q: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA…
A: Protein synthesis happens by a series of events. mRNA transcripted from DNA had the codons. tRNA has…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried by each of these tRNAs. a. 5′ –UUU–3′ b. 5′ –GAC–3′ c. 5′ –UUG–3′ d. 5′ –CAG–3′Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…
- A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine baseBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?The following segment of mRNA encodes an interstitial segment of a polypeptide (thedifferent codons appear separately): 5'... AAU CUA UUC AUU AAA ACC ... 3'a) Determine the sequence of the two strands of the DNA fragment from which this RNA comes. highlighting the sense and antisense strandb) What will be the corresponding amino acid sequence that originates in the translation
- Which of the following is/are true? 1. Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty acid chains. 2. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND 3'-TAGCCGATG-5' IS PRODUCED. 3. A single change in amino acid can give rise to a multifunctioning protein. 4. A complementary RNA strand is produced during translation.1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match the mutation with its possible effects by placing the correct letter or letters in the blanks below. There may be more than one effect for each mutated polymerase. A mutation in the gene that codes for E RNA polymerase I RNA polymerase II RNA polymerase III Possibleeffects a. tRNA is not synthesized b. Some ribosomal RNA is not synthesized c. Ribosomal RNA is not processed d. pre-mRNA is not processed e. Some mRNA molecules are not degraded f. pre-mRNA is not synthesized