Describe the process of translating mRNA into proteins. Be sure to also include the following key terms: tRNA, ribosomes, codon, base pairs, cytoplasm, amino acids.

For questions 1-4, fill in the DNA, mRNA and/or protein sequence.... For questions 1-4, fill in the DNA, mRNA and/or protein sequence. Fill in the DNA and mRNA three nucleotides (one codon) at a time. Fill in the protein sequence by typing in the amino acid found in the genetic code table. Type in the three letter abbreviation. For example, type in "Met" instead of "Methioine". For the stop codon, type in "stop". Capitalization doesn't matter when filling in the sequences of the amino acids. You will need to have a copy of the genetic code handy when completing this activity. Remember The two DNA strands must be complementary. That is, A pairs with T and C pairs with G. The template strand of DNA is transcribed into mRNA using our base-pairing rules. When making RNA, U is used in place of T. This means that if there is an A in the template DNA strand, there will be a U in the mRNA strand. Each codon (3 nucleotides) of the mRNA is translated into an amino acid to build a protein. Look…

Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C CUAGAC UAGAUCUGCUACUAGUAACACĞU

Genetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tail

Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? [Select] • Which position shows the "A" position? [ [Select] • Which end of the RNA is the 5' end? [Select] • Which base of the anticodon "AUC" (shown in the diagram) is the 5' end? [Select] CAG GAUCAUCGUCUAGAUUGCACAAU

#17 #18 please I will give you ?

list all the steps required for mRNA to be translated into a protein

Describe the key structural features of a tRNA molecule.

How exactly do I identify a tRNA with respect to mRNA? Ie: What exactly does the tRNA do and how is it produced?

This molecule: -is involved in translation -may bind to the “start” codon on mRNA -has an amino acid attachment site at one end -has an anticodon at the other end ______