Describe the process of translating mRNA into proteins. Be sure to also include the following key terms: tRNA, ribosomes, codon, base pairs, cytoplasm, amino acids.

Q: Define the term messenger RNA (mRNA)?

A: Transcription and translation are 2 steps involved in processing of DNA to proteins. RNA molecule is…

Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…

A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid  ) is a…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Rank the following in order of size: tRNA, DNA, mRNA.

A: A transfer RNA (tRNA) is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in…

Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…

A: All the living cells are made up of protein, which act as building blocks for every organism. These…

Q: Describe how protein are created in translation. Step by step

A: The translation is the process of protein synthesis.

Q: Name and describe in DETAIL the three steps of translation.

A: Polymerization of amino acids to generate a chain of polypeptides is known as translation.…

Q: Explain the process of translation, including location, processes, and molecules involved

A: Replication, transcription, and translation are the basic process in the molecular dogma of the…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: Define transcription and translation. Give 3 ways in which they are similar and 3 ways in which they…

A: Central dogma of life is given by Francis crick in 1985.It gives an idea about flow of genetic…

Q: Define the following terms: genetic code, codon, and anticodon. What is the relationship among the…

A: DNA is the storehouse of information in living organisms. It is present inside the nucleus of every…

Q: Proteins have a variety of roles. Which role is shared with elaborately folded RNA? Being structural…

A: Proteins are biomolecules that serve diverse functional roles within a cell. Proteins that catalyse…

Q: b) Draw a diagram to show how nucleotides are organised in the structure of DNA. Note: You need only…

A: The four most important biomolecules in living things are carbohydrates, amino acids, lipids, and…

Q: Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns…

A: DNA- deoxyribonucleotides tRNA- anticodon and amino acids rRNA- ribosomes and protein translation…

Q: Describe the mRNA journey through the cell after the nucleus has given the instructions.  Describe…

A: The information contained in a gene's DNA is transferred to an analogous molecule called RNA…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are…

A: Translation of genetic code into polypeptide chain is called translation.

Q: A particular DNA sequence encodes for MRNA that then encodes for the amino acid glutamate in a…

A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: List the 4 types of protein modification and describe each in 1 sentence

A: Protein modification refer to any change in the chemical composition of proteins following…

Q: Define the following keywords: DNA MRNA protein. tRNA

A: The biological level of an organization is a hierarchy that arranges the living things from simple…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: The "TATA box" is a [DNA, RNA, Carbohydrate, protein]  sequence known as a [promoter, start codon,…

A: We all know that the central dogma of molecular biology explains that DNA codes for RNA, which codes…

Q: Protein synthesis in eukaryotes is similar to the process in prokaryotes in that both eukaryotes and…

A: According to the question, we have to mention that protein synthesis in eukaryotes is similar to the…

Q: Identify if the statement is correct or incorrect, "rRNA serves as template for the synthesis of…

A: During translation, protein is formed. A segment of DNA carries the code required for specific…

Q: Describe and explain (step by step) how DNA is Transcribed into mRNA. Then describe and explain…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: Match the concepts with their definitions or examples. Match each item to a choice: Choices: DNA…

A: Central dogma of molecular biology explains how proteins are synthesized using the information…

Q: Describe protein biosynthesis. Define transcription and translation. What enzyme…

A: The cell biology is considered as the study of cells, their structure, and their functions. The…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.

A: Answer

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: Describe the roles of RNA polymerase, ribosomes, andtRNA in producing a protein.

A: Ribonucleic acid (RNA) aids in the production of proteins in the body and is normally obtained from…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Match each aspect of transcription or translation

A: Central Dogma of Molecular Biology:It is a foundational principle that describes the flow of…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your…

A: A start codon initiates the transcription while stop codon terminates the transcription process.

Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…

A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…

Q: True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines…

A: Disclaimer: Since you have posted a question with multiple sub-parts, we will solve first three…

Q: Describe in detail all of the steps necessary to carry out translation.  Amino acids, mRNA, 30S…

A: Translation is a complex process that requires many different molecules and steps. By understanding…

Q: All of the following are true about translation EXCEPT _____.     as the ribosome moves from codon…

A: Answer :- All of the following are true about translation except - Ribosomal subunits and a…