The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are the Ribosomal small subunits Ribosomal large subunits MRNAS aminoacyl-tRNAs FRNAS RNA polymerases O Protein Polymerase complexes
Q: Translation begins with the_______ codon of mRNAand continues until a(n)_______ codon is reached.…
A: For the expression of a gene, the sequence present in a DNA molecule must be converted into a RNA…
Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…
A: Translation is a process in which protein is synthesized from the information contained in a…
Q: Which category of RNA carries amino acids for the process of translation? rRNA snRNA mRNA tRNA
A: Translation is the process of Synthesis of proteins from mrna. This process takes place in cytoplasm…
Q: What is the name of the nucleotide sequence that helps the 30S ribosomal (small) subunit find the…
A: Translation initiation proceeds through the capture of mRNA by the 30s ribosomal subunit in…
Q: Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. exons…
A: The genetic material of a cell or an organism refers to those materials found in the nucleus,…
Q: Which of the following is responsible for the ability of one gene to code for more than one type of…
A: During RNA Splicing: Introns -excised and exons - ligated together.
Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…
A: ANSWER;- N'-- C; 5'--3';
Q: All of the following participate in the process of translation except: ribosomes mRNA tRNA 35S…
A: Translation It is defined as the process of production of proteins from the mRNA transcript. In…
Q: Which of the following is a true statement concerning codons A codon Will be read by RNA…
A:
Q: Which of the following enzymes is NOT utilized in mRNA degradation? MARK ALL THAT APPLY Primase Poly…
A: Transcription: It is processed to convert DNA into RNA. It is part of the central dogma. It is…
Q: Indicate which of the following items are associated with transcription or translation. This could…
A:
Q: The synthesis of multiple different protein isoforms from just one gene in eukaryotic cells would…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which type of RNA is used as a template to build protein during translation? MRNA rRNA tRNA SİRNA
A: RNA or Ribonucleic acid is a type of Nucleic acid and is one stranded structure that is synthesized…
Q: which of the following is mismatched a- small RNA catalyic with or without proteins b- rRNA 80% of…
A: RNA is coded from DNA with the help of RNA polymerase enzyme; the process of RNA synthesis is called…
Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…
A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.
Q: Which of the following is not a type of RNA?a. nRNA (nuclear RNA)b. mRNA (messengerc. rRNA…
A: Answer- Transcription is the process of formation of RNA. There are majorly 3 types of RNA- mRNA,…
Q: The amino acids listed above that are coded by the mRNA codon
A: Protein synthesis is a major process inside our body .Our body has complex system for protein…
Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…
A: DNA translation is the term used to portray the course of protein synthesis by ribosomes in the…
Q: The process by which the information contained in mRNA is converted into a polypeptide is called _.…
A: Transcription: DNA converted into mRNA with the help of the RNA polymerase enzyme. mRNA synthesis…
Q: Match each function to the appropriate type of RNA. Messenger RNA (MRNA) Ribosomal RNA (1RNA)…
A: Introduction :- Transcription is the process of synthesis of different types of RNA molecules from…
Q: create a summary of the nucleotide pairs during the translation process
A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…
Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…
A: BASIC INFORMATION TRANSCRIPTION it is responsible for the formation of hnRNA which has the codes…
Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…
Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…
A: In molecular biology, the central dogma controls the process of transcription in which DNA is…
Q: TRNAS contain the anticodon that interacts with [Select ] [Select] TRNAS MRNAS pre-RNAS
A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum create…
Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…
A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…
Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…
A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…
Q: What type of RNA corresponds to the statement? Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA RNA FRNA…
A: RNA or Ribonucleic acid is one among different biomolecules. They are also composed of nucleotides;…
Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…
A: Transcription It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA
Q: All of the following are true about translation EXCEPT _____. as the ribosome moves from codon…
A: Answer :- All of the following are true about translation except - Ribosomal subunits and a…
Q: In the elongation stage of translation, which of the following options is correct? the polypeptide…
A: The Central Dogma of molecular biology refers to the flow of information from DNA to RNA to…
Q: Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: If you were to hybridize a eukaryotic gene to its corresponding mRNA, the two molecules would not…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: RNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides…
A: Deoxyribonucleic acid (DNA) comprises the genetic information or the instructions required by an…
Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…
A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…
Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…
A: Codon are the triple of a base pair.
Q: Which subunit of RNA Pol I| functions as an assembly platform and regulator of pre- MRNA processing?…
A: In eukaryotes the pre mRNA that is the product of transcription undergoes several steps of…
Q: The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase…
A: DNA and RNA are the biomolecules that make up the part of our genetic material. DNA is the genetic…
Q: The exon and intron sequences
A: The correct option is: 1. The exon and intron sequences
Q: of the following determines the amino acid sequence of the protein produced during the process of…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: Match the steps of transcription and translation to the location they take place within a eukaryotic…
A: Transcription is the process of making an RNA copy of a gene sequence. This copy is called mRNA. The…
Q: A __________ molecule is characterized by having a peptide-binding site, a modified 5’ guanine, and…
A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…
Q: Which of the following provide clues that a particular DNA sequence is part of protein-coding gene?…
A: A protein-coding gene is a DNA sequence that instructs the cell to create a specific protein.…
Q: Prokaryotic mRNA has some unique features compared to eukaryotic mRNA which of the following would…
A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…
Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…
A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…
Q: Which of the following molecular structures contan codons? a protein B mRNA C. IRNA D. rRNA and C
A: The genetic material contains the genetic information. It passes the information from parents to…
Q: During transcription, the nitrogen base adenine on the DNA bonds with the nitrogen base…
A: Transcription is the process in which the information from a DNA strand is copied to a messenger RNA…
Q: DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met…
A: DNA => Transcription => mRNA => Translation => Protein Transcription: Formation of RNA…
Q: Which of the following would not be found in a mature mRNA in a eukaryotic cell? A Star Codon B…
A: Select the component that is not present in mature mRNA of eukaryotic cells. The given options areA.…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
- otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. SubmitIf DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GHere is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…Suppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter