Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…
A: Complete this table of codes.
Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…
A: The amino acids are produced by the help of ribosome in the process of translation. In this process…
Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr
A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…
Q: Explain how it is possible that some tRNA molecules recognize more than one codon
A: Introduction: The process of translation involves the synthesis of the polypeptide chain with the…
Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part…
Q: Transcribe the following DNA strand into MRNA and translate that strand into a polypeptide chain,…
A: DNA is made up of small units known as genes. These genes store all the hereditary information which…
Q: Include a complete nucleotide monophosphate structure, draw the adenine-uracil basepair that would…
A: Nucleotides monophosphate are basic building blocks of nucleic acids (DNA and RNA). it is consist of…
Q: Give the codonfor methionine.
A: Proteins are macromolecules formed by long chain of amino acids. They are involved in a vast array…
Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…
A: BASIC INFORMATION GENETIC CODE These are the codes which helps in the formation of the protein…
Q: list the amino acid sequence that would be made in a ribosome using these codons: AUG CUA AGU…
A: A ribosome consists of two basic pieces of units containing a large and a small subunit. During the…
Q: Explain the genetic advantage for the codon 5'-AAG-3' to code lysine and the codon 5'-AGG-3' to code…
A: Introduction Any of the 64 distinct DNA sequences of three consecutive nucleotides that either…
Q: Provide the DNA sequencce (not RNA sequence) for the Start Codon and 3 Stop Codons.
A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…
Q: For each codon below, give the tRNA anticodon. 3. UUC 4. AUC 5. CCG 6. CGU
A: Anticodons are the three complementary bases present on the tRNA. On the basis of the anticodon, the…
Q: List possible codon sequences for the following amino acids.(a) Val (b) Phe (c) Asn (d) Gly (e) Met
A: Amino acids are coded by trinucleotides sequence is known as the codon. The first two positions in…
Q: ribe the crucial role of base pairing between codon and anticodon.
A: The hereditary material translated into messenger RNA is expressed by the triplet code (mRNA). The…
Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…
A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…
Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Mark the one, which is NOT a stop codon?
A: Stop codons are those codons which leads to the termination of the translation process. In other…
Q: Define Termination codon as they apply to the genetic code
A: Codons are the triplet of the nucleotide present in the deoxyribonucleic acid (DNA) or ribonucleic…
Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription
A: Definition: CRISPR: A segment of DNA compiled of short repetitions of base…
Q: What is the start codon? What are the stop codons? Do any of them code for amino acids?
A: Start codon can be defined as first codon of a messenger RNA transcript which is translated from a…
Q: State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends…
A: An anticodon is a trinucleotide sequence that is complementary to the corresponding codon in a…
Q: Identify the amino acid for which the codon GAG codes, and what other codon could encode for this…
A: Amino acids are coded from the mRNA sequence, which posses long specific codons. These codons are a…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…
A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…
Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence
A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…
Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…
A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…
Q: Write the codons for the following amino acids. 1. Phe 2. Val
A: Genetic codon: - It is the 3 nucleotide sequence of DNA and RNA, all bases are involved in formation…
Q: Determine which amino acid is formed from the following mRNA codon: GUA. a aspartic acid b…
A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…
Q: Identify the secondary structures present in the protein and its genes code…
A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as…
Q: According to wobble rules, what codons should be recognized by the following anticodons? What amino…
A: The tRNA is the transfer RNA that matches the mRNA codon with the set of three nucleotides,…
Q: Describe where codons and anticodons are found.
A: INTRODUCTION Anticodons are sequences of nucleotides that are complementary to codons. they are…
Q: What is the sequence of bases for the start codon and what amino acid is made?
A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…
Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: How many cases are there in which it would be possible to identify the first two nucleotides of a…
A: Codon is a three nucuclotide sequence on mRNA that determines the amino acid sequence in newly…
Q: Use the following sense DNA sequence 5'- ATGTCCTGGTAA-3' to answer the following questions below.…
A: A) The resulting polypeptide from the mutated DNA sequence is- 5'-ATGTCCTGGTAA-3' Sense DNA…
Q: he anticodon for the codon GCA is:
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…
A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…
Q: THE CODONS THAT CODE FOR THE AMIMO ACID SER (SERINE) ARE UCU, UCC,_____ AND _____
A: Codon: A three-nucleotide sequence in DNA or RNA that encodes a protein amino acid or indicates the…
Q: For each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which…
A: During translation, codons in an mRNA are read, starting with a start codon and continuing until a…
Q: Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond…
A: Polypeptides are chain of amino acids which is bonded by the peptide bonds. It is coded from the…
Q: Anticodons pair with ___ .a. mRNA codonsb. DNA codonsc. RNA anticodonsd. amino acids
A: It is a process from central dogma where protein synthesis takes place with the help of ribosomes,…
Q: identify all the amino acid-specifying codons in thegenetic code where a point mutation (a single…
A: The mutation is sudden change occurs in genetic material. It can be due to ultra-violet rays,…
Q: Which of the following is/are codon/s for Glutamic Acid? O CAA GAA O GAG O GAA & GAG CAA & CAG
A: Codons are tri-nucleotide sequences of a DNA or RNA molecule which code to specific amino acid, as…
Q: Define the terms codon and anticodon, and list three start and stop codons.
A: Codon and Anticodon plays an significant role in the transcription and translation of the DNA and…
Provide the DNA sequence (not RNA sequence) for the Start Codon and 3 Stop Codons.
Step by step
Solved in 2 steps
- Provide the DNA sequencce (not RNA sequence) for the Start Codon and 3 Stop Codons.For each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which it codes. Consult the codon table as needed. 5'-AUU-3' anticodon: 3'- -5' amino acid: 5' -UCU-3' anticodon: 3'- -5' amino acid: 5' -CAG-3' anticodon: 3'- -5' amino acid:Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
- Codons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first and second bases are identical; the identity of the third base is irrelevant. For what other sets of codons is the third base also irrelevant? For what amino acid(s) does each set code?Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter abbreviation with hyphens and no spaces in between.
- The anticodon for the codon GCA is:Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine Threonine