The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which codes for a protein involved in muscle growth. What is the sequence of this region? T C GA TOP OF GEL ||

This is a list of molecular changes that could happen during DNA replication, transcription, mRNA processing, or translation. For each, determine whether or not the change will be passed down through generations of cells after it occurs. Explain your answer.  C->G point mutation in the DNA of a coding region of a gene A->T point mutation in the noncoding region of a gene An error in transcription changes the mRNA sequence such that what was an amino acid-coding codon in the DNA sequence is now a stop codon in the mRNA sequence. An error in translation causes the amino acid alanine (nonpolar) to be replaced by the amino acid glutamic acid (polar and negatively charged).

What is the length (in amino acids) of the protein* encoded by the mature processed mRNA? *Assume Met is cleaved.

In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútation

Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?

The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.

Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.

You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'

This is the sense strand of a mammalian gene. Determine the sequence of the mature mRNA. Assume transcription starts approxiamtely 25 bp downstreams from the TATAAT box, that the 5' splice site is AG/GUAAGU and that the 3' splice site is AG\GN.  / marks the 5' splice site and \  marks the 3' splice site. N  means any nucleotide. (In this problem, there are no branch point A's or polyY tracts.  Please mark the splice sites as defined above. (5'=/ and 3'=\) and underline the mature mRNA. Do not use alternate splicing. TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGT ATGATAGGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATAATTAAGCACAGGCATGCA GGGATATCCTCCAAATAGGTAAGTAACCTTACGGTCAATTAATTAGGCAGTAGATGAATAAACGATAT CGATCGGTTAGGTAAGTCTGAT

Why does the sequence ITLIIFGVIAGVIGTILLI more likely to contain a membrane-spanning sequence?