The chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved. Bisulfite was treated ribosomes. The bisulfite was subsequently removed, and the amount of protein produced was determined using a translation assay. Why do you think we need a DMSO treated control group instead of a group not treated with anything?

Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…

A: Replication, transcription, and translation are used by all cells to keep track of their genetic…

Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…

A: A three-letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid. These…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…

Q: What would be the modifier to add to this HCPCS code?

A: HCPCS Level II codes are a combination of alphabets and numerals assigned to medical services,…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which  RNA transcript is formed from DNA. Various type of RNA are…

Q: A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete…

A: The eukaryotic DNA is composed of coding and non-coding sequences, almost 90% are non-coding…

Q: Protein X is a soluble, secreted protein. It has an N-terminal ER import sequence that allows it to…

A: The proteins residing in the endoplasmic reticulum (ER) are translated on membrane-associated…

Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?

A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…

Q: sRNA acts as a marker, flagging the inhibitory protein for ubiquitination and allowing translation…

A: Proteins are synthesized by the process of translation and are modified after post-translational…

Q: Several common antibiotics affect some strains of bacteria's ability to carry out transcription…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: YFP-SC35 encodes a splicing factor. You would expect this molecule to be localized in what…

A: The process of transcription occurs in the nucleus. By this process, mRNA gets synthesized from the…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of formation of protein using the information encoded in the mRNA. mRNA…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Actinomycin D inhibits DNA-dependent RNA synthesis. This antibiotic is added to a bacterial culture…

A: Antibiotics are isolated from microorganisms (bacteria). They use antibiotics to inhibits the growth…

Q: You are working on a protein for a research project. The protein does not express well in…

A: Yeast is a eukaryotic organism that possesses a network of internal membranes to sort proteins to a…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…

A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…

Q: why is GTP hydrolysed in translation termination in bacteria? What are the by-products of…

A: The translation termination occurs when the stop codons are placed near the A site. These include…

Q: You’re going for a bike ride, and as your muscles work harder, your body needs to produce more of…

A: Genes are specific sequences in DNA that code for specific protien required for cell functioning.…

Q: 5' Figure 2 below is a schematic diagram illustrating a short gene with 5000 bp of an unknown…

A: Transcription is defined as a process in which a transcript (RNA) is formed.  It is a unidirectional…

Q: The following enzyme has an exact integer number of turns. What is the length and amount of amino…

A: Enzyme are usually composed of proteins while some enzymes are ribozymes (RNA enzymes). Proteins are…

Q: Refer to figure, which shows the distribution of histone H2A.Z on nucleosomes near a transcription…

A: The DNA is compactly packed in the nucleus because of the presence of the histone proteins which are…

Q: In the picture below (representing RNA transcription) match A-E to whether they are 5' or 3' ends. A…

A: The information recorded inside the DNA sequence of one or more genes is transcribed into a strand…

Q: Which of the following concerning progeria are false? Choose all that apply.

A: 1. Regularly, Zmpste24 slices pre-lamin to eliminate 50 amino acids.Zmpste24 is a catalyst engaged…

Q: This diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the…

A: Transcription is the process of formation of mRNA using DNA as template. This is possible with the…

Q: The locations of the TATA box in two species of yeast, Saccharomyces pombe and Saccharomyces…

A: The process of transformation of information from the deoxyribonucleic acid (DNA) into the molecule…

Q: Several examples of antisense RNA regulating translation in bacterial cells have been discovered.…

A: Introduction  Gene silencing is the technique by which the expression of any gene can be inhibited…

Q: How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron…

A: Restriction digestion analysis of any band that is subjected to the process of reverse transcription…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Eukaryotes modify mRNA with an m7G cap: an  N7-methylated guanosine linked via a 5′ to 5′…

A: The capping of mRNA is a mechanism that prevents the mRNA strand from being degraded by exonucleases…

Q: How do you think that transcription randomizes positions of nucleosomes and repression restores the…

A: As per the honor code, we only answer one question at a time therefore we are answering the first…

Q: If the lacZ protein breaks down lactose, is it worthwhile to make it when there is no lactose…

A: The prokaryotic gene regulatory system is known as operon system in which they regulates the…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.