Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.

The pioneer round of translation of an mRNA is very important to identify potentially dangerous mRNAs if per chance they possess aberrant in frame translational stop codons. Their detection leads to rapid degradation through the NMD pathway. What indications would the cell use to signal that an mRNA possesses an in frame stop following the pioneering read? Choose one. a) The mRNA has a shorter Poly A tail since it is not being efficiently translated b) If the cap binding protein is no longer associated with the cap it signals to the cell that the mRNA is no longer translatable. c) A stalled ribosomal complex on the mRNA is clearly detectable and since the translational machinery cannot initiate protein synthesis it is recognized as toxic and is degraded by the 26S proteasome. d) If the mRNA contains intron sequences then it is quickly recognized by the ribosomes as being abnornal and is degraded rapidly by the 26S proteasome. e) mRNA species that are still bound by key factors that…

In bacteria, a transcription experiment in vitro with purified RNA polymerase holoenzyme is fairly straightforward. In eukaryotes, it is not. Explain this observation, including what would be meant by the term “holoenzyme” for a eukaryotic RNA polymerase.

The following DNA sequence has been determined from DNA isolated from a bit of prehistoric amber material (picture). It corresponds to a complete transcriptional unit without introns. Use the Genetic Code to predict the primary sequence of the polypeptide encoded by this preserved DNA. (Show relevant molecular intermediates, and provide detailed and appropriate labels)

Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?

Introns are often very large and the cell has devoted mechanisms of eliminating them once they are excised from the pre-mRNA. Following intron excision, what specific ribonucleolytic enzymes or complexes contribute to eliminating the intron RNA immediately after it is excised from the pre-mRNA? Briefly describe the role of each step/enzyme and how it affects its RNA substrate

A common feature of many eukaryotic mRNAs is the presence of a rather long 3′ UTR, which often contains consensus sequences. Creatine kinase B (CK-B) is an important enzyme in cellular metabolism. Certain cells—termed U937D cells—have lots of CK-B mRNA, but no CK-B enzyme is present. In these cells, the 5′ end of the CK-B mRNA is bound to ribosomes, but the mRNA is apparently not translated. Something inhibits the translation of the CK-B mRNA in these cells. Researchers introduced numerous short segments of RNA containing only 3′ UTR sequences into U937D cells. As a result, the U937D cells began to synthesize the CK-B enzyme, but the total amount of CK-B mRNA did not increase. The introduction of short segments of other RNA sequences did not stimulate the synthesis of CK-B; only the 3′ UTR sequences turned on the translation of the enzyme. On the basis of these results, propose a mechanism for the inhibition of CK-B translation in the U937D cells. Explain how the introduction of short…

Protein levels and mRNA levels for a particualr gene don’t always match.  For example, the GCN4 gene in yeast is always producing mRNA, but the Gcn4 protein is only made when the cells are starved.  A.    what is one mechanism by which changes in mRNA levels are not always matched by changes in the protein product of that mRNA?

Consider the mechanism of the enzyme RNase:   What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain.   What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.

Polypeptides can be translated in vitro. Would a bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would a eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why not?