and enzyme O which cannot lead to the production of any molecule is coded by allele O. A part of the coding DNA strand for enzyme A: GAC GTG CGC GCC A part of the coding DNA strand for enzyme B: GAG GTG GCC GCC 5. Compare the non-transcribed strand coding for enzyme A to that coding for enzyme B. 6. Identify the type of mutation involved in this case. Justify. 7. Write the ami no acid sequence for both enzymes. 8. “Mutations can lead to diseases or to genetic diversity"Justify by referring to parts A and B. Second letter U A G UUUPhe UUC S UUA ) Leu UCU UCC UCA UCG UGUT UAU1 UACJ Ser UAA Stop UGA Stop A Tyr UGCCYS UUGJ UAG Stop UGG Trp G CUU CUC FLeu CCU CAU1 CÁC CAA Gin CGU CGC Arg His Pro CỦA CCA CGA A CUG CCG CAG CGG AUU ACU ACC AAC JAs AAA AAU AGC Ser AGA Arg AGGJ AGU AUC Fle A AUA Thr ACA AUG Met ACG AAG Lys GUU GUC G. GUA GCU GCC Ala GGU GGC Gly GAUT GACJ Asp Val GGA GGG GCA GAA) Glu GAGJ GUG GCG G First letter Third letter

2. Consider the following DNA molecule. Assume this is the DNA sequence of the entire chromosomes. Assume there are no introns. 3' AATTAGCAGATGCATGATGCAATTACTAGCATGTAAGTA 5' 5' TПААТСGTТСТАСGTACTАCGTTAATGATCGTACATTCAT 3' Based on your knowledge of open reading frames, list the amino acid sequences of the possible protein or proteins that could be produced from this DNA sequence. You may use any codon table of your liking to complete the work. a. b. Suppose there was a sister chromatid generated from the chromosome sequence shown above. What would be its DNA sequence (provide the sequence in the space below. Be sure to identify the 5' and 3'ends)?

1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50

25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St