Use the chart here to answer the following question. Second Base in Codon U A G UUU) UCU UAU] UACTyr UGU] U UGC Cys UUC Phe UCC U Ser UAA Stop UGA Stop A UAG Stop UGG Trp CAU] CACJ UUA] UCA UUGLEU UCG CU) CỤC Leu CCU ССС CCA CCG CGU) His CGC CỦA CUG Pro CAA] Arg CGA Gln CAG CGG AUU) AUC lle AUAJ AUG Met or ACG Start GUU ACU ACC AAU] AAC Asn AGU A. AGC Ser Thr AAA ACA AGA] AGG] Arg AAGYS GCU GCC GCA GCG GAU GẠC Ala GAA) GGU Asp GGC Gly GGA U GUC| G Val GUA GUG) GAG Glu GGG G List the three amino acids coded for in the following genetic code. Write your answer in the following format (xxx, xxx, xxx) using three letter abbreviations for the amino acids. AAUGACGGU First Base in Codon Third Base in Codon

First letter U U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine A AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG C Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC A CAA CAG Histidine Glutamine AAU AAC Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC AGA AGG Arginine GGA GGG AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC Arginine Serine Glycine Which mutation could result in the removal of a site for glycosylation or phosphorylation? DOAGUO AGUO AGUAG Third letter с

If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C                                                 5’  AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA            CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC       UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG       ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC       UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA       GGUAGAAGCCGCUGGGGCUUGGGGCU-3’

2. please answer this asap

Please answer A, B, and C for codon sequence 4 only

Use the table below to help you answer the following questions. THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION UUU UCU UAU UGU Phenylalanine Tyrosine Cysteine UCC Serine UUC UAC UGC UA UCA UAA Stop UGA Stop Leucine UUG UCG UAG Stop UGG Tryptophan CU CCU CAU CGU Histidine CUC CAC CGC Leucine Proline Arginine CUA CA CAA CGA Glutamine CUG CCG CAG CGG AU ACU AAU AGU Asparagine Serine AUC Isoleucine ACC AAC AGC Threonine AUA ACA AAA AGA Lysine Arginine AUG Methionine Start ACG AAG AGG GUU GCU GAU GGU Aspartate GUC GCC GAC GGC Valine Alanine Glycine GUA GCA GAA GGA Glutamate GUG GCG GAG GGG Original DNA DNA TACGCTAT GAG C Protein Methionine-Arginine-Tyrosine-Serine Mutation #3 DNA TACGCTATCGAGC How would describe this mutation? (choose ALL that apply) Substitution Deletion Frameshift Silent Insertion

Please answer A, B, and C for codon sequence 1 only

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated? The genetic code has been provided for you below. Second letter U C A G UAU UACJ UAA Stop UGA Stop A UAG Stop UGG Trp UCU ) UUU) Phe UUC J UGU U UCC UGC, U UUA LE Ser UCA -Leu UUG, UCG CAU САС His CAA CAG Gln CUU CCU CGU CGC Arg CỤC ССС Leu -Pro CỦA ССА CGA CUG СCG CGG AAC FAS AAGLYS AUU ACU AAU AGU Asn Ser AUC ile AUA AUG Met| ACG AGC AGA Arg AGG J АСС - Thr АСА AAA GAU Asp GACJ Ala GAA GUU GCU GGU U GUC Val GUA GGC Gly GGA GCC GCA GAG Glu GGG GUG GCG First letter Third letter

w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf

Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’