Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is _____.
5' TCA 3'
|
||
3' ACU 5'
|
||
3' UCA 5'
|
||
3' UGA 5'
|
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps with 1 images
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC (assume transcription is from left to right)? Indicate clearly the 5' and 3' ends of your transcript. 5'-GAUGUUUAC-3' 5'CUACAAAUG-3' 5'-CAUUUGUAG-3' 5'GUAAACAUC-3arrow_forwardIf the sequence of a coding strand of a gene is 5' ATGGCAT 3', the sequence of the MRNA would be: 5’AUGGCAU 3' ОЗ ТАССGTA 5' 3' UACGGUA 5' 5' ATGGCAT 3' O 5' UACGGUA 3'arrow_forwardBelow is a segment of RNA, transcribed from a DNA sequence. Use the codonchart to help answer the questions below. 5’ AUG/CCU/ACG/GAC/UGG/CCU 3’ a. What polypeptide would be generated by this sequence? b. The RNA is mutated to: 5’ AUGCCCACGGACUGGCCU 3’. What type of mutationhas occurred? Show the new polypeptide chain. c. The RNA is mutated to: 5’ AUGCCUACGGACGGGCCU 3’. What type of mutationhas occurred? Show the new polypeptide chain. d. The RNA is mutated to: 5’ AUGCCUACGGACUGACCU 3’. What type of mutationhas occurred? Show the new polypeptide chain.arrow_forward
- The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the sequence of the double-stranded DNA that encoded the mRNA. Label the DNA 5’ & 3’ ends, and which strand of DNA is the template strand and which is the non-template strand.arrow_forwardWhat enzyme is missing/not shown in this diagram? And which letter represents the leading strand?arrow_forwardThe complement to a coding strand has the sequence 5' - TACTTTAGGATC - 3'. What is the MRNA strand for this sequence?arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education