Translate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'

Q: From the picture provided, which colored option (exon variant) will give me: 1. start codon 2.…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…

A: Complete this table of codes.

Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…

A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA   Hb A…

A: Specific DNA sequences encode hemoglobin, a critical molecule for oxygen delivery in red blood…

Q: mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’…

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What…

A: Threonine is a type of amino acid. Amino acids are the building block of proteins. These are…

Q: 9 Which of the following statements about transcription is not true? In both prokaryotes and…

A: Transcription is the process by which genetic information encoded in a gene's DNA sequence is copied…

Q: Find 5’ UTR and 3’UTR of Mrna 5’  AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: RNA-induced gene silencing can be accomplished by cleaving and degrading MRNA encoding for a…

A: The RNA-actuated quieting complex, or RISC, is a multiprotein complex, explicitly a…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…

A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…

Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…

A: In transcription, the template strand is the strand of DNA that serves as the template for the…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU nonsense Refer to…

A: Genetic codes are genetic information present in the nucleotide sequences of mRNA (messenger RNA)…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: eseg pL oseg sy non UCC UAU sko C. UAC UGA dos UGG UUA UCA UAA dois dois CGU ne UAG UCG dil CAU CUC…

A: Genetic code The combination of three nucleotides called codon . Each codon codes for an amino acid…

Q: The sigma subunit of bacterial RNA polymerase ________________________.   is required for the…

A: RNA polymerase "core" from E. coli consists of five subunits: two alpha (α) subunits of 36 kDa, a…

Q: First letter U C G U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA…

A: The central dogma is a fundamental principle in molecular biology that involves the transfer of…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above  b. Write…

A: The coding strand is complementary to the template strand.  The template strand is the DNA sequence…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: The process of gene expression involves the process of transcription followed by the process of…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts…

A: The mRNA is produced from the templates stand of DNA by the transcription process and polypeptide…

Q: he question with gene sequence to predict amino acid sequence.

A: introduction  Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…

A:

Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…

A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Transcript the template DNA (write in mRNA codons) *

A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…

Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…

A: Translation is the formation of protein from mRNA. mRNA is a sequence of ribonucleotides which…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Complete the labels for the following diagram of translation. NOTE: A is the product of this…

A: Translation is the second step of gene expression in which information from mRNA is encoded into the…

Q: ure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at sition…

A: Transcription is a process in which RNA is formed with the help of template strand of DNA. It…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand…

A: Central dogma of life describes the flow of genetic information from the genetic material, DNA , to…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.