Translate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'

015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp

GGU ACG UUG GGG CUC CAU or CCA UGC AAC CGG GAG GUA doesn't work look for the answer

Do not use Ai

Please do not copy paste from web I will report if you do it.

Read instrxutions and complete MRNA CODON TABLE.

Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’

GCT GAC ATC CTC CTC mutated DNA sequence           mutated mRNA sequence           mutated amino acid sequence Above is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.

Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences

FIRST BASE UUU- UUC UUA UUG U CUU- CUC -Phe -Leu DNA Sequence tRNA Sequence (anticodon) -Leu CUA CUG AUU- ACU AUC lle ACC AUA ACA Met or AUG Start ACG- GUU GUC GUA GUG mRNA Sequence (codon) AMINO ACID Sequence SECOND BASE C -Val UCU- UCC UCA UCG- CCU CCC CCA CCG GCU GCC GCA GCG Ser -Pro Thr Ala AAG GAU UAU Cys UAC UAA Stop UGA Stop UAG Stop UGG Trp CAU- CGU -His CAC CGC CAA CGA -Gin CAG CGG AAU- AGU- AAC- AGC AAA- AGA AGG GGU- ASP GGC GGA GGG GAC- GAA GAG UGU- Tyr UGC- Asn Lys G Glu Arg 2 1. In your bag is a specific DNA sequence. 2. Copy that sequence in the box below labeled DNA sequence 3. Transcribe the sequence in the appropriate box. 30 Ser 4. Determine the appropriate anticodon sequence. 5. Translate the appropriate sequence into an amino acid sequence using the codon chart above 6. Using the contents of the bag, create your protein. Arg Gly THIRD BASE