DNA m RNA 5-ATGTCTGGATAG-3' 3-TACAGACCTATC-5' DNA Transcription mRNA synthesis) 5'-AUGUCUGGAUAG-3' mRNA Translation Protein synthesis) N-Met-Ser-Gly-C Fig.: Steps Leading from DNA Sequence To Protein Primary Sequence
Q: What is the advantage of the evolution of various floral inflorescences in different angiosperm…
A: Conflicting theories approximately the origins of irregular flowers and how they have coevolved with…
Q: One cost to sexual reproduction is that looking for a mate costs time and energy. Group of answer…
A: Introduction:- Reproduction is the biological process by which genetically similar offsprings are…
Q: During the millennia in which selective breeding was practiced, why did breeders fail to uncover the…
A: Artificial selection is another name for selective breeding. It is a technique used by people to…
Q: A culture consisting of 100 litres of nutrient medium containing 12 g l-1 of growth limiting…
A: Biomass is organic matter that has been recently living or that is capable of decomposing to release…
Q: Duchenne muscular dystrophy is caused by a recessive X-linked allele. A man with this disorder…
A: A genetic condition known as Duchenne muscular dystrophy (DMD) is characterised by advancing muscle…
Q: Write down the functions of the following body system. Body System Functions 1. Skeletal System…
A: Introduction The human body has 11 distinct systems, collectively referred to as organ systems,…
Q: C. Name of organism: Features used to ID:
A: Microscopic organisms are organisms that are of microscopic size and can only be visualized under…
Q: In a survey of 1,150 women who gave birth in China in 2000, a total of 500 reported that they took…
A: Why this survey is important because to know the side effects of such drug on human body but…
Q: Give the interferences that may give false positive and false negative results in the determination…
A: Urinalysis is the process of testing the urine. The appearance , concentration and the contents of a…
Q: If a mouse has a dominant phenotype (P_), how would you determine if it is homozygous (PP) or…
A: Each gene coding for a specific trait has two alternative forms called alleles. These alleles can be…
Q: When ethanol binds to glutamate receptors it operates as a receptor ______________________ and…
A: Introduction : A chemical that mimics the behaviour of another drug and triggers an action os known…
Q: When the same gene is related to respiratory problems and sterility, it can be described as: Select…
A: Introduction: Pleiotropy happens when a gene influences several qualities. This contrasts with…
Q: From what source do bacteria obtain their requirements for mineral elements like Ca, Fe etc. in…
A: Prokaryotic creatures like bacteria need food and energy to develop, similar to what any other…
Q: Why are coal and natural gas fuels considered no renewable?
A: Non-renewable energy is a form of fuel or power which cannot be replenished; as a result, its…
Q: Answer this question xi) What is the most important step in the Gram staining procedure? Why?
A: Gram staining helps in differentiating between gram positive and gram negative bacterias. The gram…
Q: What is the map distance between the two rapid lysis mutations rª and rª given the data below? re- X…
A: Identifying the recombinant frequency in the cross can help in identifying the map distance between…
Q: Many common medications function by interrupting the normal operation of certain signal transduction…
A: Inside the cell, multiple signaling pathways run simultaneously that allow the cell to communicate…
Q: Dynamic mutations are associated with what type of diseases? Genomic imprinting diseases…
A: A dynamic mutation is a type of mutation that can occur during the lifetime of an organism, as…
Q: W.Compared with 1990s, more people are killed by cancer in 2000s and in 2010s. Determining right…
A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…
Q: What factors might give rise to variation in the sizes of the colonies?
A: Bacteria grow on solid media as colonies. A colony may be defined as a visible mass of…
Q: n E. coli, the genes purC and pyrB are located halfway around the chromosome from each other. These…
A: Transformation, conjugation, and transduction are the three ways that DNA can be transferred between…
Q: You can carry out matings between an Hfr and F strain by mixing the two cell types in a small patch…
A: In the mating experiment, the Hfr bacterial strains frequently yield chromosomal gene recombinants.…
Q: Define Diffusion, Osmosis, and Semi-Permeable Membrane.
A: The premise that a cell is the basic building block of life underlies the study of cell biology,…
Q: Why do some viruses infect only animals and others only humans? How do viruses overcome these…
A: Viruses are ultrasmall pathogenic pathogens which can only grow inside a host cell. The viruses can…
Q: Hemodynamics are the dynamics of blood flow. Can the Bernoulli's equation be used to study…
A: "Blood" is an extracellular matrix made up of plasma, red blood cells, platelets, and white blood…
Q: The regulation of the blood glucose level represents an important feedback loop in the hu- man body.…
A: The mechanism through which the body keeps blood glucose levels, particularly glucose…
Q: 7. A couple with widow's peaks, an autosomal dominant trait, have two grown daugh- ters and one…
A:
Q: An elderly couple was killed in an accident. No surviving relatives are known, so their estate have…
A: ABO blood group has three alleles that are- IA, IB and i. IA and IB alleles are codominant with each…
Q: Why is it necessary to inoculate the KIA medium all the way down to the bottom of the tube during…
A: Answer : it is necessary to inoculate the KIA medium all the way down to the bottom of the tube…
Q: 10. In plants, excess glucose produced in photosynthesis is stored as J. Lipid K. Cellulose L.…
A: Introduction By converting light energy into chemical energy through a process called…
Q: TASK No 4 A patient of 48 years old complains of irritability, fatigue, weight loss with increased…
A: Pathology is the science branch in which the disease is diagnosed by means of studying the various…
Q: Describe the structure and function of miRNA, snRNA, and lncRNA, which represent the three major…
A: miRNA, siRNA and lncRNA are three different types of non-coding RNAs that are found in a eukaryotic…
Q: Can you think of anything that would prevent meiosis from occurring in an organism whose genome is…
A: Cell division is a biological process that involves production of two identical daughter cells from…
Q: For these organisms to develop into functional offspring of that species, which one of the following…
A: Introduction Embryology is a branch of science which deals with the study of embryonic development.…
Q: Y-linked 이마 In the pedigree shown, indicate whether each of the following inheritance patterns is…
A: Autosomal dominant are effected parent in l generation. Y linked traits are related
Q: 41) Dideoxyribonucleotides (ddNTPs) are unusual in both the 2' and 3' hydroxyl groups have been aced…
A: Normally dNTPs that is the deoxy nucleotide tri phosphate are inserted into the growing DNA chain by…
Q: List at least three features of eukaryotic genomes that are not found in bacterial genome.
A: Introduction: In eukaryotic and prokaryotic cells, the DNA has a different structure and chemical…
Q: Adjacent plant cells have narrow channels called plasmodesmata that pass through the cell walls of…
A: Introduction: Plasmodiumdesmata, which are somewhat cylindrical in shape, are lined by the plasma…
Q: citrate cycle
A: Citric acid cycle: It is also known as TCA cycle or Kreb's cycle. It is a series of chemical…
Q: Two different genes control the expression of kernel colour in Mexican black corn: black pigment…
A: Introduction : Genetic traits are passed down through inheritance from parents to their offspring,…
Q: Cocaine operates as a __________________________, leading to feelings of euphoria, as well as…
A: Drug addiction is a growing problem in many parts of the world. Other than the conventionally…
Q: Vermilion eye color in Drosophila is sex-linked and recessive. What would be the phenotypes of male…
A: The sex-linked disease means the gene for the disease is present on X-chromosomes and is recessive…
Q: Pick a disease caused by a microbe and explain its background, fun facts, transmission route
A: Microbes are tiny organisms some of which are pathogenic and cause diseases. Bacteria and protozoans…
Q: Does a single fingerprint pattern run in your family? Why are fingerprints unique to every…
A: Fingerprints are the patterns that are left behind when an individual presses their finger onto a…
Q: A researcher, who is examining a sample of cells of the same types at different stages of cell…
A: Cell cycle is the process through which a cell divides to produce the new cells. It is divided into…
Q: In some fruits, the floral parts are persistent even up to maturity. Identify these parts. Consider…
A: Introduction Flower is the reproductive part of the plants. Sometimes it has both male and female…
Q: Genes encoding toxins are often located on plasmids. A recent outbreak has just occurred in which a…
A: The plasmids are little circular DNA pieces that are distinct from chromosomal DNA. They are mainly…
Q: An important evolutionary innovation and a major difference between the limbs of extant lobe-finned…
A: The scientific theory of evolution by natural selection was first proposed by Charles Darwin in…
Q: According to Jonathan Drori, angiosperms evolved a "more intelligent" way of reproducing by…
A: Angiosperms are the largest groupof flowering plants on earth. and it is most diverse part of land…
Q: Fill in the type of research methods in the following questions. A total of 100 patients with…
A: Research methods These are the methods, procedures, or methods used in the gathering of information…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleSARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?
- The transcriptional complement of the DNA strand with the code 3’ TAA-CAT-GCT 5’ is5'-AGA-ACT-AAA-CTA-TCG-CTT-CGT--3' mRNA: original protein: mutated mRNA: mutated protein:DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
- Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…