1. A gene can be devned as the entire transcription unit, including the nucleotide sequencewithin the DNA that is transcribed into an RNA molecule. The diagram below represents aprotein coding gene.DEF5'113'3'l15'TranscriptionTranscription start sitetermination siteCa. Label A-G.b. What constitutes the protein-coding region of a mature MRNA molecule?

Name: 1. A gene can be devned as the entire transcription unit, including t
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 1. A gene can be devned as the entire transcription unit, including the nucleotide sequencewithin the DNA that is transcribed into an RNA molecule. The diagram below represents aprotein coding gene.DEF5'113'3'l15'TranscriptionTranscription start sit

INTRODUCTION The process of copying a segment of DNA into mRNA known as transcription. In the DNA…

Answered: a. b. What constitutes the…

Science

Biology

a. b. What constitutes the protein-coding region of a mature mRNA molecule?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they would occur during pre-mRNA processing in eukaryotes. Pre-MRNA Exon 1 Intron Exon 2 Pre-MRNA processing MRNA Exon1 Exon 2 AAAAA 3 Export to cytoplasm Translation Recognition and binding the 3' AAUAAA sequence by specific proteins Attachment of snRNP U1 to the 5' splice site Formation of a bond between the guanine in the 5' splice site and the adenine of the branch point Binding of the snRNP U4, U5 and U6 complex to the spliceosome Addition of the 5' cap Release of the intron as a lariat structure and splicing of exon 1 and 2 Addition of the poly(A) tail Binding of snRNP U2 to the branch point Cleavage at the poly (A) site
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Tryptophan Tryp high Event Ribosome does not stall at Trp codons Region 2 of the leader pairs with region 3 Ribosome covers part of region 2 of leader Transcription is terminated before structural genes are transcribed
5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU 3'
1.Describe the journey of a protein, from its synthesis to its final destination 2. Explain the different stages of transcription and the role of the elements involved with the right terminology (template vs. non-transcribed strand, promoter, stop sequence, TATA box, general and specific transcription factors, RNA polymerase II, etc.); 3. Explain what the maturation (modifications) of pre-messenger RNA consists of and its role
The foloing dagram represents a transciption unit (a gene) and corresponding RNA transcripts being synthesized. ONA molecule +A RNA molecules transcnbed from DNA Is the promoter located at postion A or B? OaA 0&B Ocksmpossible to detemine this from the information presented
1. Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC -3' 56 1 11 + ---+--- ----+-- * a. Draw a green box around the promoter. b. Label the template strand of the DNA on the sequence above. C. Write the sequence of the mRNA. Anticodon sequence: --+--- 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG ---+-- -5' d. Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. e. Give the sequence (and indicate the directionality) of the anti-codon on the tRNA that inserts the 2nd amino acid into the newly made peptide. f. Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?
Please help me to answer the TRANSCRIPTION PROCESS: 1. Briefly describe the synthesis of mRNA in the transciptuon process 2. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence GCCATATTG. Thank you very much for your help.
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine
1. The following is the partial DNA sequence of Gene A. Note: The underlined sequence (from position 20-54) represents the promoter for Gene A and the underlined and italicized sequence (from position 71-90 represents the ribosome binding (RBS) site of Gene A. Transcription begins at and includes the bold T/A base pair at position 60. 10 20 30 40 50 60 70 --- 5 ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC 3 TAGCCAGAGCCGATGATGTATTTG TATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG Promoter 80 90 100 110 120 130 140 --- 5' СAGGTAТCGGTCTGATСТАССТАGСттстсттстстстстсССССGCGGGGGCTGTACTATCАTGCGTCG 3 GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC RBS 150 160 170 180 190 200 210 --I- - -I- -- 5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA 3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT What are the first 4 amino acids encoded by Gene A? Write the N and C terminal ends. Hint: Find the DNA coding strand,…
1. For each of the sequences, place an X in the box to indicate the process most immediately affected by deleting the gene sequence. Only choose one process for each sequence. Process most immediately affected Gene Sequence deleted replication transcription RNA processing translation Shine Dalgarno AUG codon oric Pribnow box DnaA box -10 sequence 3' splice site Ter site TATA sequence UGA codon primase guanlyltransferase enhancer mediator 2. For each of the proteins, place an X in the box to indicate the process most immediately affected by deleting the sequence. Only choose one process for each sequence. Process most immediately affected Gene Sequence replication transcription RNA processing translation deleted Tus EF-Tu Sigma subunit DnaA Release factor sliceosome repressor DnaB IF3 Rho protein ORC polyA polymerase MCM helicase U1 telomerase antocodon