.  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC

List and describe the important proteins involved in transcription (that are found around the replication fork).

State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends labeled.

The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'.AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. d Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 -41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?

Read instrxutions and complete MRNA CODON TABLE.

A set of nucleotides in an original DNA strand reads TACGCGAAT transcribe the short DNA sequence. translate the short DNA sequence.

The following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…

point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三 囲 Y pre-MRNA:| I囲2 L

Describe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.

In your own words