.  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…

A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: the 12/23 rule is violated then two similar segments can become part of the same gene

A: V(D)J genomic recombination joins single sequence segments to write an intensive repertoire of…

Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…

A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…

Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…

A: Through the replication process, the information from one DNA molecule is replicated to create two…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: Given this mRNA strand: 3’ -   AUGAGGAAGGUA   - 5’; what are the components of the polypeptide?

A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts…

A: The process of prokaryotic transcription results in messenger RNA transcripts. Translation and…

Q: Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first…

A: DNA DNA is a genetic material from which amino acid sequence or polypeptide chain are made.

Q: Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’…

A: The DNA helix is unwound right before the active site for polymerization by the RNA polymerase,…

Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…

A: Introduction:  DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: t the following DNA sequences to RNA sequences. Sequence # 1:…

A: Transcription is a process where the DNA is read and an mRNA transcript is synthesized. This mRNA…

Q: From standpoint of replication and transcription, explain how RNA polymerase is allowed to…

A: DNA is a double standard molecule.  RNA is a single standard molecule.  RNA is formed from DNA…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.