d. O b. protein coding DNA that is transcribed into RNA and then translated into protein O c. non-protein-coding DNA that is transcribed into several kinds of small RNAs with biological function O d. DNA that is translated directly without being transcribed non-protein-coding DNA that serves as binding sites for reverse transcriptase A

a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR =  3'UTR =

Which process is illustrated in the diagram? T 3' 5. 3' Replication Transcription ORNA processing Translation Gene expression 5' 3' inm 13' 15'

Explain how degeneracy of the genetic code makes cells better able to accomodate mutations.