1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctqctc 61 tcggcggccc tggccctgac cgagacctqg gccggtgagt gcggqtcggg agggaaatgg 121 cctctgccgg gaggagcgag gggaccqcag gcgggggcgc atgacctcag gagccgcgcc 181 gggaggaggg tcgggcgggt ctcagcccct cctcaccccc aggctcccac tccatgtggt 241 atttctacac ctccatatcc cggcccagcc gcggggagcc ccgcttcatc tcagtgggct 301 acqtqgacqa cacccaqttc qtgaggttcg acagcgacqc cgcgagtccg agagaggagc 361 cgcgggcgcc gtggatagag caggaggggc cggagtattg ggaccggaac acacagatct 421 acaaggccca ggcacagact gaccqaqaga gcctqcggaa cctgcgcttc tactacaacc 481 agagcgaggc cgttacatga ccccqgcccg gggcgcaggt cacgactccc catcccccac 541 gtacggcccg agtcgccccg agtctccggg tccgagatcc gcctccctga ggccgcggga promoter: nucleotide 1-108; highlight in yellow exon #1: nucleotide 109 - 285; highlight in green intron (there is only one intron in this gene); highlight in light grey exon #2: nucleotide 455 - 567; highlight in blue start codon: nucleotide 161-163; bold the font stop codon: nucleotide 498-500; bold the font 5' UTR: italicize the font 3' UTR: italicize the font

Q: Ulla Unigriffin DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | MRNA: amino acids:

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…

A:

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: If 20% of the DNA in a guinea pig cell contains adenine nucleotides what percentage is cytokines…

A: A DNA double helix is formed by complementary pairing of bases, Purine bases bonding with…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: I want to know how can I make RNA transcript through next dna sequencing. 5'ATGATCTTTAAAGGGCCC 3'

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: 4. What is the process in which water is released from plants' leaves in the form of water vapor? a.…

A: Transpiration is the process of water movement through a plant and it's evaporation from the aerial…

Q: Let’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient…

A: Sickle cell anemia is a recessive disorder.

Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…

A: To identify: The mutation in the given DNA sequence

Q: Mutations conferring resistance to bactericidal agentssuch as __________ or bacteriophages

A: Bacteria are organisms that have a single cell and are considered the most primitive organisms on…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: 5'--AUG UCG UAC ACU GCG --3' Make a change in this sequence. Write a different version of this…

A: Given  mRNA sequence  5' AUG UCG UAC ACU GCG 3'   Mutation  The sequencial change in the nucleotide…

Q: DNA Replication takes place during and the end result is

A: The suitable answer to your problem will be: DNA replication takes place during S-phase of…

Q: DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase…

A: Hybridization permits the distinguishing and cloning of explicit qualities, investigation of levels…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding…

A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…

A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…

Q: What is the format of the above sequence and why?

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: ure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at sition…

A: Transcription is a process in which RNA is formed with the help of template strand of DNA. It…

Q: Identify the type of mutation present in the CDS and discuss the implications on the protein.

A: Mutations are random alteration in the DNA structure which leads to mis-reading of Information on…

Q: Use the chart to determine the correct amino acid that this DNA would 1 point code for - ATA

A: Introduction:-  In order to determine the gene sequence based off an mRNA template. We can simply…

Q: Styles Editing In cattle, the RR genotype calls for a red cow; the WW for a white cow; and the RW…

A: We are answering first question only. For rest of questions pls Repost.

Q: Enumerate and define the steps/processes involved in replication.

A: Replication is the process in which two identical copies of DNA molecules are produced from the…

Q: Refer to the sequence below to answer the following questions. 5’-…

A: DNA is a double-stranded molecule. Each strand has a polarity, such that the 5'-hydroxyl group of…

Q: Which reading frame gives you the longest amino acid sequence? 5'3 Frame 1 5'3 Frame 2 5'3 Frame…

A: In the world of molecular biology, understanding reading frames is crucial for deciphering genetic…

Q: Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after…

A: Introduction- N-terminal methionine cleavage plays an important role in protein synthesis in…

Q: 15-16. The ______ ( name the structure at the orange arrow) is attached to the ______ (name the…

A: In case of internal fertilization the embryo develops within the mother body. After completing the…

Q: Please draw or send me a picture of the structure of DNA and label the parts. Thank you very much.

A: Deoxyribonucleic acid: DNA is a genetic material that is present within the nucleus. It was…

Q: please help me find the answer

A: The given figure shows the chemical structure of a compound. A chemical structure is defined as an…

Q: cggcaggagc cccccgacct cccaggcgga ccgccctccc tccccgcgcg cgggttccgg gcccggcgag agggcgcgag cacagccgag…

A: When designing primers for a specific gene, it is crucial to carefully analyze the given nucleotide…

Q: You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1:…

A: The human genome is a complete set of nucleic acid sequences for humans, encoded as DNA in the 23…

Q: 121 Paragraph have the necessary permissions to upload the file. Save a Copy apter 9-1 What is the…

A: as per our instruction, we are supposed to give the answer to only one question, and also u have not…

Q: A change in the structure of a protein that renders it non-functional is: Delineation Denaturation…

A: There are 300 amino acids in nature. However, just 20 of them have been found in the human body.…

Q: How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa…

A: To ascertain the total count of amino acids comprising the protein encoded by the provided gene…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: https://docs.google.com/document/d/1divV998XUZp3yZP3FsGEjfjwcKqNFh2iplV62Pu-kEc/edit?usp=sharing…

A: Independent nursing action and its rationale:- 1. Intervention:- Encourage psychological…

Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG

A: The initial stage of gene expression, transcription, uses information from a gene to build a…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: The sense strand is the DNA strand that has the same sequence as mRNA, which uses the antisense…

Q: CUGCUGUGCAGAUGCUGGACG

A: A missense mutation occurs when there is a mistake in the DNA code and one of the DNA base pairs is…

Q: None

A: Protein Sequences ProteinSequenceChlamydomonas reinhardtii Kinesin II Motor…

Q: the complementary strand the 5'and 3' ends and identify corresponding codon as lled V, H, L, T, P,…

A: DNA is a double-stranded helical genetic material that contains hundreds of genes that code for…

Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…

A: Introduction The central dogma of molecular biology describes the flow of genetic information from…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.