You study the expression of the hexose kinase gene and capture the following electron micrograph ofthe gene being expressed.MRNA120ORI4060AGATACGCGATGATATTACTGCTAAAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG3'TТCGAGCTCTСGTCGTCGAGAПААТАТСGGGATGCАСТАТС5'RNApromoterpolymerasePractice Question 4G)You also study the expression of different mutants for this gene.Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change thesequence of the protein produced? Why or why not? If it does change the sequence of protein besure to write out the new sequence. If it does not change the protein sequence, what effect (if any)would you expect it to have on expression of the gene?For mutant C answer the following:Does this mutation change the sequence of the protein produced? Why or why not?If it does change the sequence of protein be sure to write out the new sequence.If it does not change the protein sequence, what effect (if any) would you expect itto have on expression of the gene?120ORI40603'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5’5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3'promoterribosome

Name: You study the expression of the hexose kinase gene and capture the fo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You study the expression of the hexose kinase gene and capture the following electron micrograph ofthe gene being expressed.MRNA120ORI4060AGATACGCGATGATATTACTGCTAAAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG3'TТCGAGCTCTСGTCGTCGAGAПААТ