20-22. TBX5 is a gene found in vertebrates which is expressed in the heart and forelimbs during development. Parts of the first and last coding exons of the human TBX5 gene are shown below, with start and stop codons in bold: Partial first coding exon: 5' -ACCATGGCCGACGCAGACGAGG-3' Partial last exon: 5' -GTGGAGCGACAATAGCTAAAGT-3' 20. Which primer pair would you use to amplify full length TBX5 coding sequence? a. 5'-ATGGCCGACGCAGACGAGG-3'and 5'-GTGGAGCGACAATAGCTAA-3' b. 5'-ATGGCcCGACGCAGACGAGG-3'and 5'-TTAGCTATTGTCGCTCCAC-3' c. 5'-ATGGCCGACGCAGACGAGG-3'and 5'-AATCGATAACAGCGAGGTG-3' d. 5'-CCTCGTCTGCGTCGGCCAT-3'and 5'-GTGGAGCGACAATAGCTAA-3' e. 5'-GGAGCAGACGCAGCCGGTA-3'and 5'-GTGGAGCGACAATAGCTAA-3' 21. What are the first five amino acids of the human TBX5 protein? Second Letter Phe UCU UCC UCA UCG UGU Cys U UGC UGA Stop A UGG UUU UAU UAC UAA UAG Tyr U UUC UUA UUG Ser a. N-Thr-Met-Ala-Asp-Ala . Stop Stop Leu Trp G CUU C Cuc CUA CUG CU Leu cCC CCA CCG CAU CÁC CAA CAG His CGU CGC CGA b. N-Met-Ala-Asp-Ala-Asp ... Pro Arg c. C-Thr-Met-Ala-Asp-Ala . Gin 1st Зrd ... d. C-Met-Ala-Asp-Ala-Asp letter Ser u letter AUU A AUC AUA AUG ACU lle ACC ACA AAU Asn Thr AAC AAA AAG AGU AGC AGA AGG e. The first five amino acids Lys Arg Met |ACG could not be determined, GUU G GUC GUA GUG GCU Val GCC GCA GCG GAU GÁC Asp GGU GGC GGA GGG insufficient information Gly c Ala GAA Glu GAG DUAC5CACUuAC

Choose the correct option for following three mcqs   4.Sequences in the beginning and end of a typical human intron are: GU and AG GG and AG UA and UA UG and GA UU and UU   5.In the later stages of a splicing reaction U1 snRNP is replaced by: U4 U5 U4 and U5 U2 None of the above   6.Which of the following statements about RNA splicing is FALSE: It occurs after mRNA synthesis is complete Splicing machinery is bound to the CTD of RNA Pol-II Recruitment of U2 snRNP is facilitated by BBP and U2AF The spliced intron has the shape of a lariat Splicing of some RNAs does not require any proteins.

The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3'. What will the sequence of the transcript from this gene be? 5' AGUCCUAGGCUAGGCAU 3 5 ATGCCTAGCCTAGGACT 3' 5 AUGCCUAGCCUAGGACU 3' 5' MAUGCCUAGCCUAGGACUAAAAAAAAAA 3" 5' AGTCCTAGGCTAGGCAT 3" V.

Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Intron 1 Intron 2 1 100 s100 base pairs 1100 2100 3100 4100 Positions 200-203 = Start codon Positions 4800-4802 = Stop codon Figure 2. (i) The transcript first produced by ABC gene would be approximately how many nucleotides long?

The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.

a. How can a single eukaryotic gene give rise to several different types of mRNA molecules?b. Excluding the possible rare polycistronic message,how can a single mRNA molecule in a eukaryoticcell produce proteins with different activities?

Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA):   5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA.  2. Indicate the amino acid sequence of each of them.

"The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a common exon 2" - what does it mean if a "first exon" is "spliced to a common exon 2"? Does it mean that Exon 1 is attached to Exon 2, but Exon 1 is not part of the translated protein - similar to the below schematic?   mRNA Option 1: [Exon 1a][Exon 2][Exon 3]....   mRNA Option 2:[Exon1b][Exon2][Exon 3]   mRNA Option 3: [Exon1c][Exon2][Exon 3]

MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene. The TATA box and kozak sequences are shown in parenthesis. Wild-type: 5’-ATGGCC​[TATAT]ATGTCACTTGACTACGCAGCC​[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ What is the resulting polypeptide from the wild-type protein?