Self-splicing reaction G-binding site 3' CUCUCU p A AGGGAGGE Intron Exon Exon 5 PÇUÇUÇU-OH AG AGGGAGG G-OH AG PAGGGAGGE Linear intron 5 aCucucuu Spliced exons FIGURE 8-18 The self-splicing intron from Tetrahymena executes two transesterification reactions to excise itself from RNA. Reactions in exon splicing Intron но 5' O=P- O- Exon 1 5 Exon 2 First transesterification 5' 2' O-P-O -0-- 3' Second transesterification 5' 2 Spliced exons 3' он Excised lariat intron 0 = 3' oxygen of exon 1 0 = 2' oxygen of branch point A 0= 3' oxygen of intron FIGURE 8-17 Two transesterification reactions take place in the splicing of RNA: first, to join the 5' donor end of the intron to the internal branch point (first reaction in Figure 8-16) and, second, to join the two exons together (second reaction in Figure 8-16).

Self-splicing reaction G-binding site 3' CUCUCU p A AGGGAGGE Intron Exon Exon 5 PÇUÇUÇU-OH AG AGGGAGG G-OH AG PAGGGAGGE Linear intron 5 aCucucuu Spliced exons FIGURE 8-18 The self-splicing intron from Tetrahymena executes two transesterification reactions to excise itself from RNA. Reactions in exon splicing Intron но 5' O=P- O- Exon 1 5 Exon 2 First transesterification 5' 2' O-P-O -0-- 3' Second transesterification 5' 2 Spliced exons 3' он Excised lariat intron 0 = 3' oxygen of exon 1 0 = 2' oxygen of branch point A 0= 3' oxygen of intron FIGURE 8-17 Two transesterification reactions take place in the splicing of RNA: first, to join the 5' donor end of the intron to the internal branch point (first reaction in Figure 8-16) and, second, to join the two exons together (second reaction in Figure 8-16).

Name: By comparing Figures 8-16 and 8-17 with Figure 8-18,speculate what fea
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: By comparing Figures 8-16 and 8-17 with Figure 8-18,speculate what features of RNA permit self-splicing (thatis, in the absence of proteins) Self-splicing reactionG-bindingsite3'CUCUCU p AAGGGAGGEIntronExonExon5PÇUÇUÇU-OHAGAGGGAGGG-OHAGPAGGGAGGELinea

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
TATA TATAAT ATG STOP codon(s) AGGAGG CCUCCU ACCATEG GACA NAMENNI KEHIAKET III 11 11 11 11 Universal START codon Anti-Shine-Dalgama sequence found on ribosome Shine-Dalgamo consensus sequence Prokaryotic motif for RNAP RNA transcription termination motif downstream of STOP codon where CPSF binds Kozak consensus sequence Eukaryotic motif upstream of TATA Eukaryotic motif for RNA pol TAA and TAG and TGA Prokaryotic motif upstream of TATAAT
SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A
3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.
mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus
mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…