Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding sequences. Label template strand: 5’-ACTGTGACCTTGACTGTCGATACGATG-3’ 3’-TGACACTGGAACTGACACGTATGCTAC-5’

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA   Hb A…

A: Specific DNA sequences encode hemoglobin, a critical molecule for oxygen delivery in red blood…

Q: 9 Which of the following statements about transcription is not true? In both prokaryotes and…

A: Transcription is the process by which genetic information encoded in a gene's DNA sequence is copied…

Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…

A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Find 5’ UTR and 3’UTR of Mrna 5’  AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: Below is the sequence of the yeast S cerevisiae GCN4 gene including 100 bp upstream and 100 bp…

A: Introduction to the topic of introns:Introns are non-coding regions of DNA that are transcribed into…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts…

A: The mRNA is produced from the templates stand of DNA by the transcription process and polypeptide…

Q: b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts…

A: The process of prokaryotic transcription results in messenger RNA transcripts. Translation and…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the…

A: Genetic codes are stored in the form of trinucleotide sequences (codons) in the mRNA.The mRNA gets…

Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…

A: mRNA stands for messenger RNA( Ribonucleic acid).  Protein translation is a process of making…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction  Gene expression is the process through which a gene's information is utilised in the…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: ure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at sition…

A: Transcription is a process in which RNA is formed with the help of template strand of DNA. It…

Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…

A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: If the promoter is here and transcription starts here…

A: Transcription is the process of formation of RNA using DNA as a template.

Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…

A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…

Q: What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’

A: Transcription: Transcription is a process where the DNA is used as a template to synthesize mRNA.…

Q: . Here is part of a gene: - 5' - 3' If the bottom strand of the DNA is the template strand, what…

A: The central dogma is a theory explaining the unidirectional flow of genetic information. According…

Q: What type of RNA is involved in the post-transcriptional modification illustrated below? 5' 5' 3' 5'…

A: Post transcriptional modification is a very important step in an eukaryotic cell, where the primary…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Q: b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts…

A: Hair pin loop is a self complementary Terminator sequence which is formed when the RNA transcription…

Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…

A: Introduction  Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: Transcription  Formation of RNA over DNA template is called transcription.  Translation The process…

Q: Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of…

A: Gene is a hereditary unit which helps in transfer of genetic information. Genetic information is…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.