20 ORF for gene X e for gene X above has a hypomorphic mutation (which you name Mutation #1) that is on the diagram. Based on the experimental data below, what specific sequence e mutation most likely in? pe Суре direction of transcription 70 3' +1 in

5 Terminator Transcription stops 5' Transcription continues Antiterminator 4. pt) Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which responds to guanine, and the other to adenine. The accompanying diagram shows a guanine riboswitch. Base pairing between free guanine (blue) and a particular cytosine residue within the aptamer determines the riboswitch conformation. a) What condition in the cellular environment would favor each of the riboswitch configurations?

1- Given the following genome: G C G C G C G C G C A G A G A G A G   Construct a De Bruijn graph using all k-mers from the sequence, with k = 4.  Construct the same graph, but with k=8  asap please

Pls help ASAP

22. ere to search Normal AUG AAG UUU GGC GCA UUG UUA leu stop met lys phe gly ala Mutation AUG AAG UUU AGC GCA UUG UUA Met lys phe ser ala leu stop What type of mutation has occurred according to the diagram above? point mutation frameshift mutation no mutation has occured chromosomal mutation

1.Your goal is to design a strategy to create thisfinal pDHFR plasmid for fusion protein expressionfrom the materials available:You have an empty pET21a expression vector and another vectorthat contains the fusion protein nucleotide sequence (pBluescript + GST-DHFR-His). (#) indicatesbp location ofenzyme cut: a.EcoRIonly, HindIII only, NotIonly, EcoRI and HindIII, EcoRI and NotI, or HindIII and NotI? b.Briefly explain the rationale for your selection. Please connect your rationale to the need for compatible ends without any further manipulation and required directionality of the DHFR fusion protein coding sequence relative to the T7 promoter that will drive its expression. c.What is the final size(kb)of your desired pDHFR plasmid ligation product based onyour design? d. Complete the chart providedto indicate thesize of all fragments(in bp)resultingfrom complete digestion of each plasmid givenyour strategy, andthe fragment(in kb)from each you would isolate for ligation.Please mind…

4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).

33. For the following gene, which type of regulatory sequence has likely been deleted in mutant 1?

18. Shown below are the results of a series of coinfections of E. coli B using T4 rlI- strains similar to those employed by Benzer in his deletion mapping experiment. Each strain contains a different deletion mutation. The ability to produce wild-type progeny phage is indicated by (+), (0) indicates no wild-type progeny. A D A B D E Which order of deletions is most consistent with this data? a. CDBEA b. DCEAB C. ABECD d. CDEAB e. EDCBA

21