a) Indicate the chronological order the following RNA processing events by indicating anumber (from 1 to 9) in the table next to the description provided.Pre-mRNA processing eventRecognition and binding the 3' AAUAAA sequence by specific proteinsAttachment of snRNP U1 to the 5' splice siteFormation of a bond between the guanine in the 5' splice site andthe adenine of the branch pointBinding of the snRNP U4, U5 and U6 complex to the spliceosomeAddition of the 5' capRelease of the intron as a lariat structure and splicing of exon 1 and 2Addition of the poly(A) tailBinding of snRNP U2 to the branch pointCleavage at the poly (A) siteOrder (1-9)

Step 1 Here's the chronological order of the pre-mRNA processing events: Pre-mRNA processing…

Answered: a) Indicate the chronological order the…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 29CTQ: A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that...

See similar textbooks

Similar questions

A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
All eukaryotes possess a surveillance pathway referred to asnon-sense-mediated mRNA decay (NMD). Its principalfunction is to eliminate mRNA transcripts with prematurestop codons. Such faulty transcripts are detected duringtranslation and subsequently destroyed by removal of the 5′cap followed by degradation by a nuclease. Describe howpremature stop codons are detected and what type of errorcauses them.
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA orrRNA. (Please note that I am not looking for the function of the 5’ cap, but for the mechanismrestricting capping to messenger RNA.)
Arrange the following list of eukaryotic gene elements in the order in which they would appear in thegenome and in the direction traveled by RNA polymerase along the gene. Assume the gene’s singleintron interrupts the open reading frame. Note thatsome of these names are abbreviated and thus do notdistinguish between elements in DNA versus RNA.For example, splice-donor site is an abbreviation forDNA sequences transcribed into the splice-donor sitebecause splicing takes place on the gene’s RNA transcript, not on the gene itself. Geneticists often usethis kind of shorthand for simplicity, even thoughit is imprecise. (a) splice-donor site; (b) 3′ UTR;(c) promoter; (d) stop codon; (e) nucleotide towhich methylated cap is added; (f) initiation codon;(g) transcription terminator; (h) splice-acceptorsite; (i) 5′ UTR; (j) poly-A addition site; (k) splicebranch site.
Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G Cap aminoacyl tRNA synthetase proofreading elF4E [Choose ] Binds ribosome A site Translation initiation in eukaryotes Translation initiation in Bacteria binds mRNA cap in eukaryotes Binds ribosome E site Correct charging of a tRNA with amino acid Cap-independent translation initiation of some viral mRNAs [Choose ] [Choose ] [Choose ] [Choose ]
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
Help me figure out how I should interpret and read these graphs. We are looking to see whether the m6a acceptor mutant will have an impact on splicing. Just need a detail breakdown thanks. I am presenting at journal club and need help interpreting will the goals in mind. We are currently conducting experiments to understand how the splicing of circE7 relates to the splicing of linear E6*I. Goal is to determine whether the mutation impact splicing. Trying to understand whether m6A will impact splicing. Sm should impact splicing ratio. My PI stated that the results show that it inhibited linear splicing and promoted backsplicing. I need a detailed explanation for the entirety so I can understand
41. The following 9 TRNAS have anticodon loop regions that base pair with the mRNA in the ribosome. Using your knowledge of tRNA-MRNA base pairing and the genetic code chart (+lecture slides), indicate the MRNA codon message being read by the ribosome as well as the1-letter amino acids that is generated. Anticodon Anticodon Anticodon Anticodon 4 Anticodon Anticodon 6. 2 5'-IAG-3' 5'-UAU-3' 5'-АAА-3' 5'-CUC-3' 5'-GAU-3' 5'-AGA-3' codon MRNA 5'-__-3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 1 letter amino acid Anticodon Anticodon Anticodon 8 7 5'-CCG-3' 5'-GUU-3' 5'-CGC-3' codon 5'-__-3' 5' 3' 5' _3' mRNA 1 letter amino acid
The following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor binding site) of bHLH transcription factor FOSL1. C 1 2 3 4 5 6 7 8 9 10 11 position Would you expect this sequence to be recognized by a monomer, a homodimer, or a heterodimer of the protein? Explain your answer. (short phrases are sufficient; please write your answer into the template below) A- В I A -l expect FOSL1 to bind as a: (monomer, homodimer, heterodimer; please choose) B - short explanation: information content (bit) !!

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS