Q: 3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can…
A: The complete genome of E.coli is 5.44 million base pairs. The genome is replicated entirely in one…
Q: 1. What does PCR allow you to do with DNA?
A: The separated and identified PCR results are then used to characterize the STR region under…
Q: 5. Describe the process of DNA sequence of interest detection, using these terms appropriately,…
A: Introduction: DNA sequencing method is used to determine the exact base sequence in a DNA. Three…
Q: What are the forces that stabilizedouble stranded DNA?
A: As DNA is i double helix structure having 2 complimentary strands, it is necessary to maintain this…
Q: How are Recombinant DNA formed?What is the difference between genetic modification and selective…
A: Recombinant DNA technology is a new approach to modify the genome of a host organism by joining two…
Q: 1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What…
A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…
Q: 1. If 30% of DNA is Adenine, what percent is Thymine?
A: DNA ka double helical structure that consists of sugar phosphate and bases. the sugar that is…
Q: 3. The Watson-Crick model pictures DNA as as the step. spiral staircase with the as the handrails…
A: DNA has a double-stranded structure in which two strands run in an anti-parallel direction. DNA…
Q: 5. If you are able to successfully incorporate foreign DNA to your host organism, what are your…
A: A foreign DNA is a DNA that is transferred into a species from other source and not that of parent.
Q: Which of the following alternative steps cannot be employed in the DNA extraction because it would…
A: You have asked multiple questions. I will answer 1st question, as allowed by guidelines. Asked :…
Q: 7. If the electrical leads were reversed by mistake (red connected to black), what would be the…
A: Gel electrophoresis is a technique which is used to separate the DNA on ths basis of size, charge…
Q: Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940.…
A: DNA and RNA are considered as a genetic material. DNA is inherited or transferred from parents to…
Q: 1 What pairs with A? 2. What pairs with C? 3. DNA is semi-conservative. Why is this an efficient and…
A: The DNA (deoxyribonucleic acid) is the hereditary material of an organism. The DNA is a part of the…
Q: The functions ascribed to the genetic material are replication, expression, storage, and mutation.…
A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity…
Q: what is A structure composed of DNA and associated proteins that in total contain the genome of an…
A: Nucleus is a double membrane bound dense protoplasmic body which controls all cellular metabolism…
Q: What are the frequency and percentage distribution of amino acids in the polypeptides coded by the…
A: Introduction When a DNA gene is disrupted or damaged in such a way that the genetic message carried…
Q: 1. How does the DNA structure reflect its functions? 2. What are the important features of the DNA…
A: The DNA molecule is made up of two strands that form a double helix shape as they coil around one…
Q: If you will use apple or strawberries instead of banana do you think the result would be the same in…
A: All living things pass hereditary information from one generation to another using DNA as the basic…
Q: 1. Which pieces of DNA are the most informative? Why?
A: as per our company guidelines we are supposed to answer only first 1question. Kindly repost other…
Q: 6. Assume that you are working at a biotechnology company and you are assigned to a project in which…
A: Protein purification is a set of procedures for isolating a single or a few proteins from a…
Q: 2. How does the universality of the genetic code make the recombinant DNA technology possible?
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…
A: DNA sequencing Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.
Q: 19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins…
A: DNA's molecular structure is referred described as a "double helix." Two connected strands that…
Q: 1. What is the role of salt and dishwashing liquid in the extraction/isolation of DNA from yeast and…
A: "DNA extraction or DNA isolation" is a procedure or a method wherein DNA is purified by physical…
Q: 4. Why do the dideoxynucleotides stop DNA extension?
A: The sequences of nucleotides on the DNA strand (dNTPs) constitute the genetic code or genome. The…
Q: 4. DNA dissolves in water, but not in ethanol. Explain what happened when the ice cold ethanol came…
A: DNA is the genetic material and it is found in most organisms. DNA extraction is one of the first…
Q: 1) Recombinant DNA technology and selective breeding are 2 techniques that seek to produce desirable…
A: WHAT IS RECOMBINANT DNA TECHNOLOGY AND SELECTIVE BREEDING ? - Recombinant DNA technology simply…
Q: What is the purpose of cell dissolution? 2. What is the purpose of DNA separation? 3. What is the…
A: Cell lysis : The method in which the cell membrane is broken down to release the inter-cellular…
Q: blueprint for life?"
A: TE tris-EDTA buffer is an type of biological buffer system that used during isolation of a DNA which…
Q: 4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide…
A: Base substitution is the simplest type of gene mutation that involves the swapping of one nucleotide…
Q: 4. What determines the direction of DNA movement in a gel? 5. What determines the rate of DNA…
A: The technique of gel electrophoresis uses a variety of gels where majorly agarose gel is used for…
Q: 7) The Human Genome project cost billions of dollars to complete. What was it and do you think it…
A: For long, many people thought of the Human Genome Project as biology's "moon shot." The United…
Q: 3) Erwin Chargaff is considered one of the pioneering scientists in the field of molecular biology.…
A: According to the Chargaff’s Rule, DNA consists of nucleotides and contains nitrogen bases (Adenine,…
Q: Explain the following relationship: DNA formats RNA, which makes proteins.
A: DNA and RNA are two types of nucleic acids. DNA provides the code for the cellular activities while…
Q: 4. Draw and label a model that shows how complementary base-pairing is used to create a new strand…
A: DNA replication occurs within the cytoplasm of prokaryotic cells and nucleus of eukaryotic cells.…
Q: What is the purpose of adding of (a) warm salt water, (b) detergent, and (c) alcohol on the…
A: Extraction of DNA from a banana involves mashing, filtration, precipitation and extraction.
Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…
A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…
Q: 1) Why can the genome be thought of as life's instruction manual? 2) What is the difference between…
A: DNA is genetic material in most of organisms which carries genetic information and transfer it into…
Q: What proportion in the human genome are actual genes? 2. What are tandem repeats?
A: Introduction All of an organism's genetic data is included in its genome. It is made up of DNA…
Q: 2. In your own words, define a gene.
A: A protein is a biomolecule that is made up of amino acids. They carry out many cellular processes as…
Q: WHY DO WE NEED GENETIC ENGINEERING?
A: Genetic engineering is a vast field that mainly involves using rDNA technology to genetically alter…
Q: Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to…
A: DNA polymerase is the enzyme required for replication of DNA and RNA polymerase is the enzyme…
Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…
A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…
Q: 3. If one measures a 20 ul sample of DNA with an absorbance reading at A280 mm of 0.35 and an…
A: Introduction :- DNA ( Deoxy ribonucleic acid ) is made up nucleotide units , which are made up of a…
Q: Who are the scientists that proved DNA is the transferrable genetic material and Discuss how they…
A: Introduction DNA was never thought to be the genetic material as it was so inert and lacking…
Q: Explain the importance of Isolating DNA from the cells of organisms.
A: DNA is the genetic material for most organisms. The methods used to isolate DNA are dependent on the…
Q: What is meant by ‘annotating’ the genome? How is this done? Which process occurs first? How does…
A: Asked : Genome annotation process and difference from assembly
4. what is The entire complement of DNA sequences in an organism.?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 16. The process of attaching biological functions to DNA sequences is called?2. Suppose the following base sequence was found in a 20-base DNA polymer. C-A-G-T-T-A-A-G-G-T-C-C-T-A-G-G-T-T a. What would be the bases in the complementary strand of DNA? b. What would be the mRNA strand transcribed? c. What would be the corresponding tRNA anticodons? d. What are the amino acids coded by the transcribed mRNA?8 How natural processes can change the information stored in DNA?
- 1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .5.What are the forces that stabilizedouble stranded DNA?1b. Write a DNA sequence 18 base pairs long in which each strand would form a cruciform structure if the two strands were separated. Label the 5' and 3' ends of each strand.
- 5. Shorthand DNA is written as antiparallel arrows with 5' and 3' ends. 3' a) What do the 5' and 3' ends signify? b) To which end are new nucleotides added when building a DNA strand?4. Which of the following single-stranded DNA molecules would be palindromic in the double-stranded state? (A-T-G-C-C-G-T-A, G-T-C-A-T-G-A-C, A-T-G-C-T-A-C-G, G-C-T-A-T-G-A-C)5. If 30% of the bases in human DNA are A, (a) whatpercentage are C? (b) What percentage are T?(c) What percentage are G?