1- The following Wild Type DNA codes for color in a lizard living in the Namib Desert (tan sand) a skin color of reddish brown. This lizard is preyed upon by hawks flying above. Wild Type (Normal) DNA DNA Template Strand: TAC-TTC-AAA-CCG-ATT DNA (silent strand): ATG-AAG-TTT-GGC-TAA For number 7, compare this change to the wild type in number 1. Remember that the original pigment is a different color. 7. Let us assume that the following protein (Met-Lys-Phe-Ser) changes the pigment deposited in the lizard skin to a tan color. Would this be detrimental? Would this be beneficial? Explain either answer.

1- The following Wild Type DNA codes for color in a lizard living in the Namib Desert (tan sand) a skin color of reddish brown. This lizard is preyed upon by hawks flying above. Wild Type (Normal) DNA DNA Template Strand: TAC-TTC-AAA-CCG-ATT DNA (silent strand): ATG-AAG-TTT-GGC-TAA For number 7, compare this change to the wild type in number 1. Remember that the original pigment is a different color. 7. Let us assume that the following protein (Met-Lys-Phe-Ser) changes the pigment deposited in the lizard skin to a tan color. Would this be detrimental? Would this be beneficial? Explain either answer.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 13RQ: Which of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments...

See similar textbooks

Similar questions

Which of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments phosphodiester linkage
5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC - 3¹
5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two introns in this DNA sequence. Remember introns start with GT and end with AG. (a) How many base pairs are in intron 1 and intron 2.
DNA ladder 1 DNA ladder 2 bp bp ng/Sul 10000 40 8000 40 8888 180 4000 40 -600 3000 40 500 2000 100 1500 40 1000 40 500 40 200 100 5 HILane. 8 cm Gel 0.5 ug/lane, 20 cm length gel, 1X TAE, B V/cm, 3h Please state the band length of each well (if exist) via comparing them with DNA ladder Please write if there is any unusual band pattern (smear, primer dimer). 1% agarose
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. mone formed DNA Template Strand: 3'CACGTGGACTGAGGACTCCTC5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 4. What amino acids will this mRNA code for? 3. What mRNA will be formed from the template strand of DNA? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 67
Draw the following strands of DNA5’ C-A-T 3’ as well as the complementary base pairing strand hydrogen bonded to itIt should be drawn in detail, structurally.
THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…
DNA Polymerase Holoenzyme IIlI is represented below. It consists of several domains with distinct functions. The structure capable of 5' to 3' DNA polymerization is represented by the letter and the structure capable of 3' to 5' exonuclease activity is represented by the letter B. -D DNA Pol II holoenzyme D; A А; С А;B А А; D В; D O O
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5'-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGG TG ATGTGGTGGCTATTGATTATAAACACTACÃCACCCTCTTTTAAGAAAGGAGC TAAATTGTTACATAAACC-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5-CAA TAT TCT TTG GAC GAA-3' 5'-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 O 5'-CAA TTT AGC TCC TTT CTT-3'
16/ The phosphates that make up the phosphodiester bonds in DNA have pKa 2. What is the sign of the charge on the DNA when the pH of solution is neutral? Postive Negative Neutral Not enough information given 17/ The phosphates that make up the phosphodiester bonds in DNA have pKa 2. What fraction of the phosphates in DNA are charged at neutral pH? essentially all of them about half of them about 1/4 of them none of them Not enough information given 18/ The phosphates that make up the phosphodiester bonds in DNA have pKa 2. What is the charge of Mycoplasma genitalium DNA, which is 586-kilo-base-pairs (kbp) long, at neutral pH?