L L 01:20:06 When a person is sick with a bacterial infection, doctors often prescribe antibiotics to cure the illness. Why would a doctor start treatment with a low dosage antibiotic instead of the highest dosage? O The low dosage has the same effect as the higher dosage, so the bacterial response would be insignificant between the two. O If the bacteria is exposed to the highest dosage right away, it may mutate into an even stronger pathogen, which would make the person more sick. Releasing the highest dosage may lead to the bacteria developing resistance to it, which would mean there are no other cures. O The higher dosage can lead to many unwanted side-effects that fail to show up in the low dosage treatments.

L L 01:20:06 When a person is sick with a bacterial infection, doctors often prescribe antibiotics to cure the illness. Why would a doctor start treatment with a low dosage antibiotic instead of the highest dosage? O The low dosage has the same effect as the higher dosage, so the bacterial response would be insignificant between the two. O If the bacteria is exposed to the highest dosage right away, it may mutate into an even stronger pathogen, which would make the person more sick. Releasing the highest dosage may lead to the bacteria developing resistance to it, which would mean there are no other cures. O The higher dosage can lead to many unwanted side-effects that fail to show up in the low dosage treatments.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter26: Prokaryotes: Bacteria And Archaea

Section: Chapter Questions

Problem 8TYK

See similar textbooks

Similar questions

This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids
The World Health Organization (WHO, 2017) haslisted six steps individualscan take to prevent and control the spread of antibiotic resistance. a.One of the recommendations is “Never demand antibiotics if your health worker says you don’t need them.”Explain why when you have a flu, your health care worker would say that you do not need antibiotics. What are the other five recommendations?
What do you mean by the term "Antibiotic resistance" ? Use your own words to explain
Because of overuse of antibiotics and/or weakened governmental surveillance of infectious disease, several diseasesthat had been thought to be no longer a threat to humanhealth (e.g., pneumonia and tuberculosis) are rapidly becoming unmanageable. In several instances, so-called superbugs(microorganisms that are resistant to almost all known antibiotics) have been detected. How did this circumstancearise? What will happen if this process continues?
Antibiotic resistant bacteria are commonly found in hospitals. Why do you think that is?
A 65 year old patient undergoes a hernia repair surgery. He receives a polypropylene mesh implant that prevents hernia recurrence. The healing goes well, but four weeks after the surgery he develops fever and sense of discomfort at the surgery site. On a physical examination, there is skin redness and fluctuating mass (palpable mass filled with fluid) around the incision. The doctor suspects that mesh got infected and plans mesh removal surgery. 1) Describe the sequence of local events during wound healing after the implantation of the mesh. For each of the stages of the wound healing process, specify cells that are involved, their role(s), signal molecules that are involved, and their roles.
We have many antimicrobial drugs to treat bacterial infections, but very few for viruses. Why is it so difficult to treat viral infections? Hint: What would the targets for the drugs be?
Before development of a vaccine against this microbe, thedisease it caused accounted for two-thirds of bacterial meningi-tis cases during the first year of life but is still the number oneleading cause of mental retardation in patients who survive seri-ous disease due to permanent central nervous system disorders.What is the microorganism?(a) Haemophilus influenzae type B(b) Haemophilus influenzae type A(c) Neisseria meningitidis(d) Streptococcus pneumoniae(e) Listeria monocytogenes
No one would dispute the facts that the use of antibiotics is extremely beneficial. Why then are there currently discussions around the idea that we as a society should be limiting our antibiotic use? What are the pros and cons of utilizing antibacterial and antimicrobial products (NOT antibiotics) on a daily basis? Do you agree or disagree that the use of antibiotics should be reduced and if so, how should it be done?
Question 1 What is a reasonable treatment for an E. coli infection? O Interferon O Antiviral drugs O Antibiotics O Quinines O Antibodies
The question below is one question I just separated the question marks 1) How are antibiotics, as a class of drugs, unique? 2)How does this facilitate resistance? 3)How are antibiotics misused?
What do you mean by antibiotic resistance? use your own words to explain