A urine sample was obtained, and the bacteria in this sample were cultured. Using the same tests as carried out previously, this sample contains Gram-negative bacteria; no Gram-positive cocci were observed. Furthermore, the Gram-negative strain has now become resistant to tetracycline and streptomycin. To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format): > sequencing results TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG ATCCCTAGCTGGTCTGAGAGGATGACCA Based on the results that were generated by BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (Top search result was Escherichia coli strain 2 for me), are you able to conclusively identify the specific strain of the bacterium causing the infection? Note that in the scientific names given to bacteria, the strain is included after the genus and species. So, for the bacterial strain Pseudomonas aeruginosa PAO1, the genus is Pseudomonas, the species is aeruginosa, and the strain is PAO1. Make sure to mention E values and % Identities in your answer.
A urine sample was obtained, and the bacteria in this sample were cultured. Using the same tests as carried out previously, this sample contains Gram-negative bacteria; no Gram-positive cocci were observed. Furthermore, the Gram-negative strain has now become resistant to tetracycline and streptomycin.
To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format):
> sequencing results
TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG
TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC
CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA
TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG
ATCCCTAGCTGGTCTGAGAGGATGACCA
Based on the results that were generated by BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (Top search result was Escherichia coli strain 2 for me), are you able to conclusively identify the specific strain of the bacterium causing the infection? Note that in the scientific names given to bacteria, the strain is included after the genus and species. So, for the bacterial strain Pseudomonas aeruginosa PAO1, the genus is Pseudomonas, the species is aeruginosa, and the strain is PAO1. Make sure to mention E values and % Identities in your answer.
Step by step
Solved in 3 steps
