Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter CHST2, Problem 6DQ
How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein that it encodes is only found in a few specific regions of the cytoplasm? Cite a few different possibilities.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process.
What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA?
a.
The pre-mRNA will be longer and the mature mRNA will be longer.
b.
The pre-mRNA will be longer and the size of the mature mRNA will not be affected
c.
The size of the pre-mRNA will not be affected and the mature mRNA will be longer
d.
The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affected
Imagine you are going to label a gene associated with apoptosis in
Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To
generate the YFP, you know the pre-MRNA looks as follows:
Unspliced YFP premature mRNA
Сap
5' UTR
Exon 1
Intron
Exon 2
Intron
Exon 3
3' UTR
Poly-A tail
If Exon 2 is also required for mRNA stability, what can be predicted
from the possible spliced alternative isoforms formed?
One of the isoforms will not have a poly-A tail
O The alternative splicing of YFP pre-MRNA prevents 5'-capping
The MRNA isoform without Exon 2 will be degraded faster than the other
isoform
Exon 2 will be added to isoform B later to correct the mistake in splicing
The protein translated from one of the mRNA isoforms will possess an
additional functional domain
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example.
ATGATAGCCAGACTCGCA
Chapter CHST2 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. CHST2 - What are some of the different roles that RNA...Ch. CHST2 -
2. What arguments support the RNA World...Ch. CHST2 - Prob. 3RQCh. CHST2 - How is bacterial DNA methylation and expression of...Ch. CHST2 - What are the three types of small noncoding RNAs...Ch. CHST2 - The mechanism for RNA-induced transcriptional...Ch. CHST2 - Although exRNAs are found in many fluids within...Ch. CHST2 - How and why are eukaryotic mRNAs transported and...Ch. CHST2 - The RNA World Hypothesis suggests that the...Ch. CHST2 - Bacterial sRNAs can bind to mRNAs through...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forwarda) Two of the following three mRNA sequences code for the same protein. Delete the sequence which does NOT code for the same protein as the other two. [ /1] #1 UUU CCU AGU GGU #2 UUC CCA AGC GGC #3 UUC CCG AGA GGA b) Despite the fact that one of the mRNA sequences above codes for a different protein, it IS possible that it will be translated into the same protein as the other two. Based on what you have learned in this unit, explain how this might happen.arrow_forward
- The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCAarrow_forwardThe base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene? The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA. Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.arrow_forwardIn eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.arrow_forward
- In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then via the Golgi, where they are released into the extracellular environment through secretory vesicles. A more easier way would be for secretory protein-producing ribosomes to be localised to a translocon in the plasma membrane, with the protein being secreted directly during translation. Consider three possible benefits of the more roundabout method for protein secretion versus the simpler, more straightforward approach indicated.arrow_forwardHere is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardThe following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…arrow_forward
- Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements Splicing of mRNA does not involve any proteins. Answer Bank Splicing occurs while the mRNA is attached to the spliceosome. In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. One mRNA can sometimes code for more than one protein by splicing at alternative sites. False statements Splicing occurs after the mRNA enters the cytoplasm but before it binds to the ribosome.arrow_forwardWhich of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestionarrow_forward"The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a common exon 2" - what does it mean if a "first exon" is "spliced to a common exon 2"? Does it mean that Exon 1 is attached to Exon 2, but Exon 1 is not part of the translated protein - similar to the below schematic? mRNA Option 1: [Exon 1a][Exon 2][Exon 3].... mRNA Option 2:[Exon1b][Exon2][Exon 3] mRNA Option 3: [Exon1c][Exon2][Exon 3]arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license