Concept explainers
Match each of the terms in the left column to the best-fitting phrase from the right column
a. Oligonucleotide | 1. a discrete part of a protein that provides a unit of function |
b. vector | 2. a collection of the DNA fragments of a given species, inserted into a vector |
c. stick ends | 3. the joining together of exons in a gene in different combinations |
d. recombinant DNA | 4. stable binding of single-stranded DNA molecules to each other |
e. syntenic block | 5. set of genes related by processes of duplication and divergence |
f. genomic library | 6. chromosomal region with the same genes in the same order in two different species |
g. genomic equivalent | 7. contains genetic material from two different organisms |
h. cDNA | 8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism |
i. gene family | 9. short single-stranded sequences found at the ends of many restriction fragments |
j. hybridization | 10. a short DNA fragments that can be synthesized by a machine |
k. alternative RNA splicing | 11. DNA copied from RNA by reverse transcriptase |
l. protein domain | 12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment |
a.
To determine:
The phrase that describes “oligonucleotide” among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
Nucleotides are made up of pentose sughar, phosphate group and nitrogenous bases. They are of four types A, T, G and C.
Answer to Problem 1P
Correct answer:
oligonucleotide: a short DNA fragment that can be synthesized by a machine.
Explanation of Solution
Oligonucleotides are small stretches of the nucleotides that are synthesized as primers or other tools of recombinant DNA technology to identify a target sequence in the genome of an organism.
b.
To determine:
The phrase that describes “vector” among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
Bacteriophage a virus for which the natural host is a bacterial cell. They are known as bacteria-eaters. They also act like vectors.
Answer to Problem 1P
Correct answer:
Vector: a DNA molecule used for transporting, replicating, and purifying DNA fragment
Explanation of Solution
Vectors are tools of recombinant DNA technology that utilizes plasmid to carry the gene of interest from donor organism to the recipient organism and help it to attach itself to the genome of the recipient thus, integrating the gene of interest.
c.
To determine:
The phrase that describes “sticky ends”among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
Pyrimidines are a chemical group that includes the nitrogenous bases cytosine, thymine, and uracil. The sticky ends form complementary pairing with these bases in DNA.
Answer to Problem 1P
Correct answer:
Sticky ends: short single-stranded sequences found at the ends of many restriction fragments
Explanation of Solution
Sticky ends are the overhangs of single stranded DNA molecule that have complementary gene sequence to each other and easily bind to the recipient DNA molecule without the help of enzymes ligase.
d.
To determine:
The phrase that describes “recombinant DNA”among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
Deoxyribose is a molecule similar to ribose, except that the 2′ carbon has a hydrogen rather than a hydroxyl group.
Answer to Problem 1P
Correct answer:
Recombinant DNA: contains genetic material from two different materials
Explanation of Solution
Recombinant DNA technology is a branch of science that studies the interaction of the genetic material and forms a DNA that contains the gene(s) of other organsism or even a part of different organism’s genome.
e.
To determine:
The phrase that describes “syntenic block”among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
The chromosomes are condensed structures that are formed during the early phases of cell division from the loose network of chromatin thread and then regain their original structure after being divided into daughter cells.
Answer to Problem 1P
Correct answer:
Syntenic block: chromosomal region with the same genes in the same order in two different species
Explanation of Solution
Syntenic block is the region inside the chromosome that contains the genes in the same order as they are present in the chromosome of a different organism belonging to a different species.
f.
To determine:
The phrase that describes “genomic library”among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
Genome is a haploid content of the organism. It consists of the genes that encode protein for the organism.
Answer to Problem 1P
Correct answer:
Genomic library: a collection of the DNA fragments of a given species, inserted into a vector.
Explanation of Solution
Genomic library is the complete collection of the small oligonucleotides or fragments of the DNA obtained from a species and then inserted into a vector to study and use the fragment in different types of recombinant studies.
g.
To determine:
The phrase that describes “genomic equivalent”among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
The model of DNA replication was proposed by the scientists Watson and Crick. DNA is a double stranded molecule that contains the gens which regulates all the functioning of the body.
Answer to Problem 1P
Correct answer:
Genomic equivalent: the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organisms
Explanation of Solution
Genomic equivalent is the total number of the DNA fragments that are present in the sufficient number that when attached in the entire length gives the genome of an organism from which they are derived.
h.
To determine:
The phrase that describes “cDNA”among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
Okazaki fragments are formed during DNA replication. They are small fragments of about 1000 bases that are joined after synthesis to form the lagging strand. The complementary DNA is formed from RNA which is demonstrated in viruses.
Answer to Problem 1P
Correct answer:
cDNA: DNA copied from RNA by reverse transcriptase.
Explanation of Solution
cDNA or complementary DNA is the stretch of nucleotides that is formed after the mRNA is used a template to synthesize DNA with the help of enzyme reverse transcriptase. The enzyme is present in viruses that form DNA strand on RNA template.
i.
To determine:
The phrase that describes “gene family”among the options given below:
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
The genes are the sequence of nucleotides that are present on the chromosomes and encode for a specific protein that plays a crucial role in the functioning of the different processes in an organism. The gene is located at specific gene loci and can be structural or regulatory in nature.
Answer to Problem 1P
Correct answer:
Gene family: set of genes related by process of duplication and divergence
Explanation of Solution
Gene family consists of the sets of genes that are derived from the same ancestral gene but have been separated into different functions or different species as a result of duplication and divergence.
j.
To determine:
The phrase that describes “hybridization”among the options given below.
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
DNA topoisomerases are a group of enzymes that assist relax supercoiling of the DNA helix by nicking one or both strands to allow the strands to rotate relative to each other. Hybridization helps in recombinant DNA which is followed by denaturartion of DNA.
Answer to Problem 1P
Correct answer:
Hybridization: stable binding of single-stranded DNA molecules to each other
Explanation of Solution
Hybridization is the process in which the DNA is denatured into single stranded molecules and allows the binding of these single stranded molecules on a nitrocellulose membrane and is attached to a probe that is extensively used in recombinant technology.
k.
To determine:
The phrase that describes “alternative RNA splicing”among the options given below.
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
Meselson and Stahl experiment describe the semi conservative replication in which both the daughter strands have a copy of parent strand. Replication is followed by splicing which is a post transcriptional modification.
Answer to Problem 1P
Correct answer:
Alternative splicing: the joining together of exons in a gene in different combinations
Explanation of Solution
Alternative splicing is the method of removal of the introns or the non-coding sequences from the mRNA transcript as post-transcriptional modification. The splicing only leads to the joining of exons to produce mature RNA.
l.
To determine:
The phrase that describes “protein domain” among the options given below.
1. a discrete part of a protein that provides a unit of function
2. a collection of the DNA fragments of a given species, inserted into a vector
3. the joining together of exons in a gene in different combinations
4. stable binding of single-stranded DNA molecules to each other
5. set of genes related by processes of duplication and divergence
6. chromosomal region with the same genes in the same order in two different species
7. contains genetic material from two different organisms
8. the number of DNA fragments that are sufficient in aggregate length to contain the entire genome of a specified organism
9. short single-stranded sequences found at the ends of many restriction fragments
10. a short DNA fragments that can be synthesized by a machine
11. DNA copied from RNA by reverse transcriptase
12. A DNA molecule used for transporting, replicating, and purifying a DNA fragment
Introduction:
The proteins are made of amino acids. The amino acids are of 20 types that combine in a varied manner to form proteins. The amino acids join together by peptide bonds. Proteins act as major substrates and reactants for the metabolic pathways. All the enzymes in the body that are crucial for the biochemical reactions are proteins.
Answer to Problem 1P
Correct answer:
Protein domain: a discrete part of a protein that provides a unit of function
Explanation of Solution
A protein domain is the proteins residues that are encoded by the gene. The proteins play very important role in the function of the genes. These protein domains are the functional unit of the mature quaternary protein.
Want to see more full solutions like this?
Chapter 9 Solutions
Genetics: From Genes to Genomes, 5th edition
- _1. Bacterial proteins that have the ability to cut both strands of the DNA molecule at certain points 2. Contain foreign DNA 3. Is made by connecting segments of DNA from different sources _ 4. General term for a carrier used to transfer a foreign DNA fragment into a host cell 5. A small ring of DŇA found in a bacterial cell 6. The procedure for cleaving DNA from an organism into small segments, and inserting the f. genetic engineering or segments into another organism a. recombinant DNA b. vector c. restriction enzymes d. plasmid e. transgenic organisms recombinant DNA technologyarrow_forwardDefine the following terms: a. DNA typing b. short tandem repeats c. DNA profile d. nucleosome e. retrotransposonarrow_forwardWhich of the following is the correct order in extracting the DNA? I. Washing of DNA II. Tissue homogenization and cell lysis III. Drying of pellet and dissolution of dried pellet IV. Precipitation of DNA from the aqueous phase V. Denaturation and separation of other biomolecules from DNAarrow_forward
- 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocityarrow_forwardA plasmid is a DNA double helix in which the ends of each of the strands of nucleotides are attached to each other, forming a circular DNA molecule. 1) True 2) Falsearrow_forwardMatch the definition on the left with the term on the right Tightly hypercolled DNA that is not in use Loosely colled DNA that is currently being used a) Chromatin b) Chromosomearrow_forward
- Four enzymes are listed below, match each to the correct definition. Definition Enzyme 4. Ligase 5. Primase 6. Gyrase 7. Helicase Answer a. Unwinds DNA b. Relieves tension in DNA during unwinding c. Links sugars and phosphates together d. Builds RNA primers C В Aarrow_forwardThe short Okazaki fragments are Select one: a. spliced together by DNA ligase b. glued together by RNA primers c. fused together by DNA polymerase d. formed into the lagging strand without splicingarrow_forwarda. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chainsarrow_forward
- Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forwardWhich of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains are coiled in a helix around a common axis. II. The purine and pyrimidine bases lie on the inside of the helix. III. The pairing of bases follows Chargaff's rules such that A pairs with U and G pairs with C. IV. B-DNA has a longer helical pitch compared to Z-DNA. O Ill only O Il only O l and II O Il and III O None are correct O , II, and II O l onlyarrow_forwardLook at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education