Campbell Essential Biology (7th Edition)
7th Edition
ISBN: 9780134765037
Author: Eric J. Simon, Jean L. Dickey, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9, Problem 19IMT
Summary Introduction
To explain:
The theme that the statement “the skin color is determined by many different proteins acting together in combination with environmental factors” depicts.
Introduction:
The skin color is regulated by the expression of many genes which control a single
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Albinism (achromia) is a genetic condition in which an individual cannot synthesize melanin from tyrosine (an amino acid), a brown pigment of the hair, skin, and eyes. These individuals lack whar?
Flamingos are not born pink, but through their diet absorb pigments that get deposited into their feathers which turns them from white to pink. Similarly, our own diet can effect the color of our skin if we were to eat high concentrations of food with absorbable pigments. For instance, if we ate a large amount of carrots and summer squash that contain beta-carotene, what color would you expect the skin to take on?'
Yellow-green
orange-green
Yellow-orange
Red
Considering that we are all made up of the same 4 nucleotides in our DNA, the same 4 nucleotides in our RNA, and the same 20 amino acids in our proteins, why are we so different from each other? For example, why do some people have sickle cell anemia and others don't?
Chapter 9 Solutions
Campbell Essential Biology (7th Edition)
Ch. 9 - The genetic makeup of an organism is called its...Ch. 9 - Which of Mendels laws is represented by each...Ch. 9 - Edward was found to be heterozygous (Ss) for the...Ch. 9 - Whether an allele is dominant or recessive depends...Ch. 9 - Prob. 5SQCh. 9 - Prob. 6SQCh. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Adult height in people is at least partially...Ch. 9 - A purebred brown mouse is repeatedly mated with a...
Ch. 9 - How could you determine the genotype of one of the...Ch. 9 - Tim and Jan have freckles (a dominant trait), but...Ch. 9 - Incomplete dominance is seen in the inheritance of...Ch. 9 - Why was Henry VIII wrong to blame his wives for...Ch. 9 - Both parents of a boy arc phenotypically normal,...Ch. 9 - Heather was surprised to discover that she...Ch. 9 - Prob. 17SQCh. 9 - Prob. 18IMTCh. 9 - Prob. 19IMTCh. 9 - For each pair of your homologous chromosomes, one...Ch. 9 - In 1981, a stray cat with unusual curled-back ears...Ch. 9 - Interpreting Data As shown in the Punnett square...Ch. 9 - There are now nearly 200 recognized breeds of dog,...Ch. 9 - Gregor Mendel never saw a gene, yet he concluded...Ch. 9 - Prob. 25BS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype: chromearrow_forwardExplain the changes that you observed in terms of change in protein structure at the molecular level of egg albumin Hint: Discuss what interactions/bonds are disrupted upon application of the treatment on the egg albumin during denaturation Heat Vinegar Rubbing alcoholarrow_forwardCH₂, H H 0=400 | | | CH₂ H H 1 HIG H-C-O H₂C-N-C-C-O-P-O-C-H 1 H 2 P=O =o HIGI HIGI HIGIN H HH H- HI HIG H- H— HHHHHH H HHHHH HHHHHHH HH Which part(s) is/are slightly polar? [Select] H 3 The top chain in part 3 is [Select ] [Select] H H 4 H H HH HH TI II H H Which are highly polar? all of these, parts 1-3 Which part(s) is/are nonpolar? [Select] H H C H 41 H HHH C- What is this molecule? (Looks scary but look how it has those tails) [Select] HH H H ✓faces When placed in oil, out towards the oil. When placed in water, part 1 faces out towards the water.arrow_forward
- 2_53392678751... material, separate from the DNA in the nucleus, and can make copies * .of themselves the lysosomes and peroxisomes. the endoplasmic reticulum. the mitochondria. the ribosomes. نقطة واحدة * :The range of the blood pH is 7.0 to 7.50 7.30 to 7.40 7.40 to 7.53 7.35 to 7.45 نقطة واحدة The . . are the rarest form of white blood cells and are involved in >arrow_forwardAbnormally stretchy skin is a symptom associated with a genetic syndrome that can result from loss of functional proteases that cleave procollagen. overactivity of proteases that cleave procollagen. over secretion of procollagen. overproduction of collagen. O all of the abovearrow_forwardCorrectly match the complementary base pairs in DNA. Adenine Guanine 1. Uracil 2. Cytosine 3. Thyminearrow_forward
- Which statement is INCORRECT? Proteins confer structural and functional properties to cells. All cells of a given organism are equivalent with regard to their protein content. Genes are stored as DNA. (D) within a given organism, the DNA content of individual cells is cell type specific. All cells of a given organism are equivalent at the genomic level.arrow_forwardAuthophagy refers to naturally regulated mechanisms of degradation and removal of dysfunctional proteins. Denaturation is the unfolding of proteins under the effects of physical factors. Now, is denaturation part of the process of authophagy?arrow_forwardExplain how structural changes in genes on chromosomes may impact proteins and have negative, helpful, or neutral consequences on an organism's structure and function.arrow_forward
- The alpha-keratin of hair is rich in the amino acid cysteine. The location of these cysteines in the protein chain is genetically determined. As a result of the location of the cysteines in the protein, a person may have curly, wavy, or straight hair. How can the location of cysteines in a-keratin result in these different styles of hair? Propose a hypothesis to explain how a “perm” causes straight hair to become curlyarrow_forwardIn denaturation of DNA and protein explain how denaturation brings about the ailment and what its effect in our body.arrow_forwardRNA molecules are more easily broken down than DNA at a high pH. This can be attributed to the fact that: RNA has a higher melting temperature than DNA. RNA contains uracil that helps break down the RNA, whereas DNA contains thymine. RNA is single stranded but DNA is double stranded. RNA is a smaller chain than DNA, which makes RNA easier to break apart than DNA. RNA contains an oxygen at the 2' carbon of its ribose sugar whereas DNA does not.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Genetic Variation and Mutation | 9-1 GCSE Science Biology | OCR, AQA, Edexcel; Author: SnapRevise;https://www.youtube.com/watch?v=bLP8udGGfHU;License: Standard YouTube License, CC-BY