Biochemistry: Concepts and Connections (2nd Edition)
2nd Edition
ISBN: 9780134641621
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 17P
Explain in about one sentence why it is important to animals for the major carbohydrate storage
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain in about one line why it is critical for animals to have branched glycogen rather than unbranched glycogen.
Compare the cellular energy (e.g. ATP) required and produced when glycogen is synthesize and hydrolyzed, respectively. Do the same for a molecular of triglyceride that contains three palmitoyl chains. Which seems to be the better way to store energy? Explain.
What is the metabolic basis for the observation that many adults cannot ingest large quantities of milk without developing gastric difficulties?
What is the benefit of fiber in the diet?
Why is it advantageous that polysaccharides can have branched chains?
No animal can digest cellulose. Reconcile this statement with the fact that many animals are herbivores that depend heavily on cellulose as a food source.
Chapter 9 Solutions
Biochemistry: Concepts and Connections (2nd Edition)
Ch. 9 - Prob. 1PCh. 9 - -D-Galactopyranose rotates the plane of polarized...Ch. 9 - Provide an explanation for the fact that a-...Ch. 9 - Why is a type O individual considered a universal...Ch. 9 - The disaccharide , -trehalose differs from the ,...Ch. 9 - A reducing sugar will undergo the Fehling...Ch. 9 - Prob. 7PCh. 9 - Prob. 8PCh. 9 - Indicate whether the structures shown are R and S...Ch. 9 - Prob. 10P
Ch. 9 - Draw (using Haworth projections) the fragments of...Ch. 9 - One or more of the compounds shown below will...Ch. 9 - Why do you suppose that the influenza virus...Ch. 9 - Prob. 14PCh. 9 - Are mannose and galactose epimers? Allose and...Ch. 9 - Prob. 16PCh. 9 - Explain in about one sentence why it is important...Ch. 9 - Prob. 18PCh. 9 - Prob. 19PCh. 9 - Prob. 20PCh. 9 - Prob. 21PCh. 9 - Prob. 22PCh. 9 - Prob. 23P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Steroid derivatives like cholesterol are also part of the lipid family. Name three useful by-products that cholesterol can be converted into within the body.arrow_forwardDescribe a pathway whereby some of the carbon from a fatty acid with an odd-numbered carbon chain could undergo a net conver- sion to carbohydrate.arrow_forwardThe enzyme phosphofructokinase transfers a phosphate from ATP to the hydroxyl group a C1 of fructose. Similar to fructose, water also has a hydroxyl group and the concentration of water is much higher than that of fructose. Explain why the phosphate is transferred to fructose and not to water.arrow_forward
- Compare the amount of ATP formed during the metabolization of glucose, proteins and a fatty acid (C16H32O16) by means of a table.arrow_forwardPart B Some nonessential amino acids are synthesized in the body by a simple transamination. The transamination between oxaloacetate, an a-keto acid, and glutamate, a amino acid with the side chain -CH₂CH₂COO proceeds according to the following reaction: OOC-CH₂-C-COO + OOC-CH₂CH₂CH COO OOC-CH₂CH₂-C-COO + amino acid 2 NH₂+ Predict the structure of the amino acid product, indicated by amino acid 2, for the reaction. Draw the molecule on the canvas by choosing buttons from the Tools (for bonds), Atoms, and Advanced Template toolbars. The single bond is active by default. Include all hydrogen atoms and formal charges.arrow_forwardCalculate the maximum number of ATP that can be generated from a mole of sucrose.arrow_forward
- Fatty acids from stored triacylglycerols (fat) are not available for gluconeogenesis. Speculate why we do not have the enzymes to directly convert fatty acids into glucose. Plants (especially seeds) do have enzymes to convert fatty acids into carbohydrates. Why are they so lucky?arrow_forwardA specific mutation of the H+-ATPase cell membrane protein causes the protein shape to be altered so that is unable to pump protons across the cell membrane. Explain how this would affect sucrose transport. [4 A]arrow_forwardExplain the function of brown fat. What does its mechanism imply about the effect of ATP concentrations on the rate of cell respiration?arrow_forward
- What is the physiological purpose of starch in a seed or other plant tissue? What is the physiological purpose of glycogen in a mammal?arrow_forwardWasting is one of the characteristics of HIV / Aids, caused by increased metabolic activity. Untreated patients quickly lose up to 10% of their body weight, with loss of muscle mass contributing most. What happens to the amino group of amino acids that are broken down in the muscles? Fully explain the process of amino acid degradation in the muscle up to urea production in the liver.arrow_forwardWhenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license