BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 6MCQ
Summary Introduction
Introduction:
A mutation can add, delete, or change nucleotides in a DNA sequence. It can also replace one base with the other. Insertion or deletion of nucleotides disrupt the reading frame and eventually changes the sequence of the encoded protein.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'.
A. The corresponding codon for the mRNA is _________ (write 5’ --> 3).
B. If this codon is translated, the codon specifies the addition of which amino acid? _______________________
A small section of a gene for a protein has the following nucleotide sequence:
GCT CTA GCT ATC TGA
Which of the following mutations would cuase a silent mutation in the sequence shown above?
a. Replacement of second adenine base with thymine base
b. Replacement of first thymine base with adenine base
c. Replacement of second guanine base with cytosine base
d. Replacement of first cytosine base with guanine base
A small section of a gene for a protein has the following nucleotide sequence:
CCT AAG GAT TCA CTT
Which of the following mutations would cause a missense mutation in the sequence shown above?
a. Replacement of first guanine base with cytosine base
b. Replacement of first thymine base with cytosine base
c. Replacement of second thymine base with adenine base
d. Replacement of seond guanine base with adenine base
Chapter 7 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 7.1 - Prob. 1MCCh. 7.1 - Prob. 2MCCh. 7.2 - Prob. 1MCCh. 7.2 - Prob. 2MCCh. 7.2 - Prob. 3MCCh. 7.3 - Prob. 1MCCh. 7.3 - Prob. 2MCCh. 7.3 - Prob. 3MCCh. 7.3 - Prob. 4MCCh. 7.3 - Prob. 5MC
Ch. 7.4 - Prob. 1MCCh. 7.4 - Prob. 2MCCh. 7.4 - Prob. 3MCCh. 7.5 - Prob. 1MCCh. 7.5 - Prob. 2MCCh. 7.5 - Prob. 3MCCh. 7.5 - Prob. 4MCCh. 7.5 - Prob. 5MCCh. 7.6 - Prob. 1MCCh. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.7 - Prob. 1MCCh. 7.7 - Prob. 2MCCh. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.8 - Prob. 1MCCh. 7.8 - Prob. 2MCCh. 7.8 - Prob. 3MCCh. 7.8 - Prob. 4MCCh. 7.8 - Prob. 5MCCh. 7.9 - Prob. 1MCCh. 7.9 - Prob. 2MCCh. 7.10 - Prob. 1MCCh. 7.10 - Prob. 2MCCh. 7 - If one strand of DNA has the sequence ATTGTCC,...Ch. 7 - Transcription copies a _____ to a complementary...Ch. 7 - Prob. 3MCQCh. 7 - Prob. 4MCQCh. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - At which stage in viral replication does the...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 1WIOCh. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Prob. 4WIOCh. 7 - Prob. 5WIOCh. 7 - Prob. 6WIOCh. 7 - Prob. 7WIOCh. 7 - Prob. 8WIOCh. 7 - How many codons are in the mRNA molecule that you...Ch. 7 - Prob. 10WIOCh. 7 - Prob. 11WIOCh. 7 - Prob. 12WIOCh. 7 - Prob. 13WIOCh. 7 - Prob. 14WIOCh. 7 - Prob. 15WIOCh. 7 - Prob. 16WIOCh. 7 - Prob. 17WIOCh. 7 - Prob. 18WIOCh. 7 - Prob. 19WIOCh. 7 - Prob. 20WIOCh. 7 - Prob. 21WIOCh. 7 - Prob. 1SLCh. 7 - Prob. 1PITCh. 7 - Where do promoters, terminators, stop codons,...Ch. 7 - Prob. 3PITCh. 7 - Review the Survey the Landscape figure in the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following enzymes adds a new amino acid to the growing chain of a protein during protein synthesis? a. aminoacyl-tRNA synthetase b. peptidyl synthetase c. peptidyl transferase d. ribosomal synthetasearrow_forwardWhich of the following mutations involve the loss of one or more nucleotides from a gene sequence? a.Base-pair substitution b.Insertion c.Deletionarrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
- Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code for a specific amino acid. The table shows the mRNA codon for each amino acid. Use the genetic code table to answer the questions. 4. The codon for tryptophan is? 5. For leucine, there are __ different options. 6.The codon GAU is for ____7. In a stop codon, if the second base is G, the first and third bases are __ and __arrow_forwardA small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA Which of the following mutations would cause a silent mutation in the sequence shown above? a. Replacement of first thymine base with adenine base b. Replacement of second thymine base with guanine base c. Replacement of first cytosine base with guanine base d. Replacement of second adenine base with thymine basearrow_forwardA small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first cytosine base with guanine base b. Replacement of final thymine base with guanine base c. Replacement of second guanine base with cytosine base d. Replacement of first thymine base with adenine basearrow_forward
- Which of the following mutations involve the loss of one or more nucleotides from a gene sequence? A. Deletion B. Insertion C. Base-pair substitutionarrow_forwardProkaryotic transcripts are _____________ since several proteins can be produced from one mRNA. a. polycistronic b. monocistronic c. tricistronic d. bicistronicarrow_forwardSickle cell anemia is an example of a genetic disease caused by a point mutation. To answer this question look at the information in chapter 3 of the OpenStax book. If you use another resource that is fine but you will need to share the link. a. Describe the specific change in the nucleotide sequence sequence from normal to mutated hemoglobin. b. Describe the specific change in the amino acid sequence from normal to mutated hemoglobin. c. Explain the structural effect that this point mutation has on the hemoglobin protein. d. Explain how this mutation affects the function of the hemoglobin protein.arrow_forward
- What is the first amino acid encoded in your protein? A. Methionine B. Asparagine C. Proline D. Cysteine Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…arrow_forwardIn Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?arrow_forwardA gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A mutation in this gene removes the first G in the strand.What is true of this mutation's effect on the phenotype?1.It will affect the phenotype because although most of the protein will be identical, the first amino acid will be different.2.It will not affect the phenotype because the protein will be identical to the original protein.3.It will affect the phenotype because all the amino acids past this point will be different from the original protein.4.It will not affect the phenotype because only the first amino acid is different from the original protein.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY