BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 4PIT
Review the Survey the Landscape figure in the chapter introduction, and then explain why a mutation in DNA sometimes causes protein function to change.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain the process of Transcription and Translation.
List three antibiotics and explain how these antibiotics inhibit the protein synthesis.
Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described
after the sequence.
Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence
of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For
example, how will the mutation affect the length and sequence of the protein? What about the function of the
protein?)
3' TACATGGTTGTGCTAATT 5'
C
Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence.
Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)
Chapter 7 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 7.1 - Prob. 1MCCh. 7.1 - Prob. 2MCCh. 7.2 - Prob. 1MCCh. 7.2 - Prob. 2MCCh. 7.2 - Prob. 3MCCh. 7.3 - Prob. 1MCCh. 7.3 - Prob. 2MCCh. 7.3 - Prob. 3MCCh. 7.3 - Prob. 4MCCh. 7.3 - Prob. 5MC
Ch. 7.4 - Prob. 1MCCh. 7.4 - Prob. 2MCCh. 7.4 - Prob. 3MCCh. 7.5 - Prob. 1MCCh. 7.5 - Prob. 2MCCh. 7.5 - Prob. 3MCCh. 7.5 - Prob. 4MCCh. 7.5 - Prob. 5MCCh. 7.6 - Prob. 1MCCh. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.7 - Prob. 1MCCh. 7.7 - Prob. 2MCCh. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.8 - Prob. 1MCCh. 7.8 - Prob. 2MCCh. 7.8 - Prob. 3MCCh. 7.8 - Prob. 4MCCh. 7.8 - Prob. 5MCCh. 7.9 - Prob. 1MCCh. 7.9 - Prob. 2MCCh. 7.10 - Prob. 1MCCh. 7.10 - Prob. 2MCCh. 7 - If one strand of DNA has the sequence ATTGTCC,...Ch. 7 - Transcription copies a _____ to a complementary...Ch. 7 - Prob. 3MCQCh. 7 - Prob. 4MCQCh. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - At which stage in viral replication does the...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 1WIOCh. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Prob. 4WIOCh. 7 - Prob. 5WIOCh. 7 - Prob. 6WIOCh. 7 - Prob. 7WIOCh. 7 - Prob. 8WIOCh. 7 - How many codons are in the mRNA molecule that you...Ch. 7 - Prob. 10WIOCh. 7 - Prob. 11WIOCh. 7 - Prob. 12WIOCh. 7 - Prob. 13WIOCh. 7 - Prob. 14WIOCh. 7 - Prob. 15WIOCh. 7 - Prob. 16WIOCh. 7 - Prob. 17WIOCh. 7 - Prob. 18WIOCh. 7 - Prob. 19WIOCh. 7 - Prob. 20WIOCh. 7 - Prob. 21WIOCh. 7 - Prob. 1SLCh. 7 - Prob. 1PITCh. 7 - Where do promoters, terminators, stop codons,...Ch. 7 - Prob. 3PITCh. 7 - Review the Survey the Landscape figure in the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- BIOCHEMISTRY Complete the series for DNA replication, transcription and translation by writing the complementary DNA strand, mRNA, tRNA and series of amino acid. Using the table given, write the hidden message on the space provided:arrow_forwardWhich mutation would have a larger effect on the protein resulting from a gene: an insertion or deletion of one nucleotide in a DNA sequence or an insertion or deletion of three nucleotides in a DNA sequence? Explain your answer.arrow_forwardWhich sequence regarding protein synthesis is correct?a. translation → transcription → mRNA synthesisb. transcription → splicing of primary RNA transcript → translocation of mRNA → translationc. splicing of introns → transcription → mRNA synthesis translationd. transcription → translation → mRNA productione. tRNA enters nucleus → transcription begins → mRNA moves to cytoplasm → protein synthesis beginsarrow_forward
- Identify the site of protein synthesis in a cell. Is the site for protein synthesis the same as that for DNA replication? Justify your answer and explain why this is necessary.arrow_forwardCreate the RNA strand to be synthesized from the DNA double strand below and explain this synthesis, including the functions of the molecules responsible for synthesis. 5-ATCGCTTGTTCGGAA-3 3-TAGCGAACAAGCCTT-5arrow_forwardList the major types of RNA molecules and their functions. Explain the importance of transcription factors. List the steps of transcription List the steps of protein synthesis. Explain the importance of protein folding.arrow_forward
- Use the mRNA coding chart above to answer these questions. he following is the base sequence on a portion of a template strand of DNA. 3 ‘ TACGCCAGTGGTTCGCAC 5 Give the base sequence of the complementary DNA strand. Give the base sequence of the strand of mRNA read from the original DNA template strand. List, in order, the amino acids that would be present in this protein? What would be the code that the methionine tRNA anticodon would carry? Suppose a mutation altered the original DNA strand so that the 6th nucleotide was changed to a T. i) How would this change the protein? ii) What type of mutation is this?arrow_forwardb) Use the DNA sequence bęlow to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence.arrow_forwardDetermine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license