
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A mutation in this gene removes the first G in the strand.
What is true of this mutation's effect on the
1.It will affect the phenotype because although most of the protein will be identical, the first amino acid will be different.
2.It will not affect the phenotype because the protein will be identical to the original protein.
3.It will affect the phenotype because all the amino acids past this point will be different from the original protein.
4.It will not affect the phenotype because only the first amino acid is different from the original protein.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Retinitis pigmentosa refers to a group of conditions that cause night blindness and loss of peripheral vision before age 20. A form of X-linked retinitis pigmentosa is caused by a frameshift mutation that deletes 199 amino acids. How can a simple mutation have such a great effect?arrow_forwardDue to a nucleotide substitution, the fourth residue of H3 in a specific tissue cell of an organism is no longer lysine. 1. Would this have an impact on Bromodomains or Chromodomains? 2. How would this affect gene expression of that region of the gene in the cell?arrow_forwardHow might a point mutation in DNA affect the phenotype. How the genome is expressed in the organism? (Please explain this at the molecular level).arrow_forward
- The human PAH gene encodes the enzyme phenylalanine hydroxylase. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. The first 9 amino acids of the wild-type human PAH protein are: MSTAVLENP The sequence below shows the first 9 codons of a mutant allele of the human PAH gene: atg tcc act agc ggt cct gga aaa ccc What type of mutation has occurred in the coding sequence? Group of answer choices silent frameshift nonsense missensearrow_forward1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-arrow_forwardScientists identify a tumor cell in rats that divides more rapidly in the presence of galactose. When they sequence the DNA of the tumor cells, they identify retroviral DNA. Explain what circumstances might have occurred that produced this phenotype.arrow_forward
- Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for tyrosine aminotransferase, a key enzyme in melanin production. If you analyze the DNA of an albino individual, of the following mutations, which one is the least likely mutation responsible for the albino phenotype? A. A substitution of A to G at 3' splicing site. B. A deletion in the TATA box region. C. An insertion after the start codon. D. An extra stretch of TTAATT in intron 1.arrow_forwardThe gene known to be mutated in cases of Agammaglobulinemia 2 (which is inherited in an autosomal recessive pattern) is the immunoglobulin lambda like polypeptide 1 (IGLL1 ENSG00000128322). What is known about the gene is recorded here: http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000128322;r=22:23573125-23580302 Please navigate to the link above and click 'show transcript table' to answer the following question: What is the NCBI accession number (including the version) of the RefSeq Match for the transcript IGLL1-202? ANSWER: The NCBI accession number (including the version) of the RefSeq Match for the transcript IGLL1-202 is "Blank 1".arrow_forwardSickle cell anemia is an example of a genetic disease caused by a point mutation. To answer this question look at the information in chapter 3 of the OpenStax book. If you use another resource that is fine but you will need to share the link. a. Describe the specific change in the nucleotide sequence sequence from normal to mutated hemoglobin. b. Describe the specific change in the amino acid sequence from normal to mutated hemoglobin. c. Explain the structural effect that this point mutation has on the hemoglobin protein. d. Explain how this mutation affects the function of the hemoglobin protein.arrow_forward
- A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?arrow_forwardout of 1 If one of the parents is found to have the mutation that causes DAD, it is most likely the statement) Row A. B. C D. Select one OA A OB. B OC. C OD. D i father father mother Diabetes mellitus and deafness (DAD) is a genetic disorder caused by a point mutation at position 3243 in human mitochondrial DNA (mtDNA), which consists of a circular genome. As suggested by the name, patients with DAD are subject to hearing loss at certain frequencies as well as Type 1 diabetes. mother After having a child born with DAD, a man and a woman decide to have their own DNA screened in order to determine who the mutation came from. mtDNA is coded for on the Y-chromosome mtDNA is inherited through sperm mtDNA is coded for on the X-chromosome mtDNA is inherited through ova because _ii (select the row that correctly completes thearrow_forwardA 30 - year - old woman was undergoing therapy for b-thalassemia,a recessive trait caused by absence of or reduced synthesis ofthe hemoglobin b chain, a subunit of the oxygen-carrying moleculein red blood cells. In this condition, red blood cells are rapidlydestroyed, freeing a large amount of iron, which is deposited in tissuesand organs. The blood transfusions the patient had received every twoor three weeks since the age of 7 to stave off anemia were furtheraggravating iron buildup. Her major organs were showing damage, andshe was in danger of death from cardiac disease. Her physician suggestedthat she consider undergoing a hematopoietic (bone marrow)stem cell transplant (HSCT). Since these stem cells give rise to redblood cells, such a transplant could potentially restore her health. Whilethis might seem like an easy decision, it is not. Advanced cases havea high risk (almost 30 percent) for transplantation-related death. At thispoint, the woman is faced with a difficult and…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education